Dataset for CDS BAK1 of Organism Anolis carolinensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A803TLD5_BAK1-02      atggcctcaagaaatggcaacgacccaacagacaggaggaggacagagat
A0A803TLD5_BAK1-01      atggcctcaagaaatggcaacgacccaacagacaggaggaggacagagat
                        **************************************************

A0A803TLD5_BAK1-02      acgcagaccatccatggaaattgcattagaagaccaggtggctcaggaga
A0A803TLD5_BAK1-01      acgcagaccatccatggaaattgcattagaagaccaggtggctcaggaga
                        **************************************************

A0A803TLD5_BAK1-02      cggaggaggtgttccagagctacgctttctaccggtatcaacaggagcgg
A0A803TLD5_BAK1-01      cggaggaggtgttccagagctacgctttctaccggtatcaacaggagcgg
                        **************************************************

A0A803TLD5_BAK1-02      gagcagactgagggggatgtgccacatgacccagaaatagctgcgatccc
A0A803TLD5_BAK1-01      gagcagactgagggggatgtgccacatgacccagaaatagctgcgatccc
                        **************************************************

A0A803TLD5_BAK1-02      gcatgagccaaatagcacaaattgccaggtgggcaggcgcctggccacta
A0A803TLD5_BAK1-01      gcatgagccaaatagcacaaattgccaggtgggcaggcgcctggccacta
                        **************************************************

A0A803TLD5_BAK1-02      ttggtgatgacatcaatgcccgctatgacaaggagttctcggaaatgttg
A0A803TLD5_BAK1-01      ttggtgatgacatcaatgcccgctatgacaaggagttctcggaaatgttg
                        **************************************************

A0A803TLD5_BAK1-02      aagtcactccagccaacaaaggacaacgcctatgagtactttattagaat
A0A803TLD5_BAK1-01      aagtcactccagccaacaaaggacaacgcctatgagtactttattagaat
                        **************************************************

A0A803TLD5_BAK1-02      agccagcagtttgtttgaaagtggcataaactggggccgtgtgatagcac
A0A803TLD5_BAK1-01      agccagcagtttgtttgaaagtggcataaactggggccgtgtgatagcac
                        **************************************************

A0A803TLD5_BAK1-02      tgttgggcttcggctacaggatggcgatccatgtataccagcatgggatg
A0A803TLD5_BAK1-01      tgttgggcttcggctacaggatggcgatccatgtataccagcatgggatg
                        **************************************************

A0A803TLD5_BAK1-02      accggcttcctgaggagaattgcccgctacatggctgattttgtgcttcg
A0A803TLD5_BAK1-01      accggcttcctgaggagaattgcccgctacatggctgattttgtgcttcg
                        **************************************************

A0A803TLD5_BAK1-02      caaccgcattgcccggtggattgctcagcagggcggatgggtaggtggac
A0A803TLD5_BAK1-01      caaccgcattgcccggtggattgctcagcagggcggatgggtggcagcac
                        ****************************************** *  * **

A0A803TLD5_BAK1-02      ctgaaagccaaattagtgttctttgtgcaggacttccaccactgccacct
A0A803TLD5_BAK1-01      t----------------------------ggacttaagcaacgtgtactt
                                                     ******   * **    ** *

A0A803TLD5_BAK1-02      cagatactcctgatttcttttgaccatgaggaatatgaggaaacacagcc
A0A803TLD5_BAK1-01      gaagta---------tgtgctgatagtggcggctgtga------------
                         *  **         * *  ***   **  *  * ***            

A0A803TLD5_BAK1-02      tctgaacagatgtggtgggaagatgatatcattcactttgtggaattctt
A0A803TLD5_BAK1-01      tct---------tgctagg-------------ccagtttgtg--------
                        ***         ** * **              ** ******        

A0A803TLD5_BAK1-02      ggtatttgattatgctggacagtgttcagtgttttaccttgttttaa
A0A803TLD5_BAK1-01      -----------------------gtgcggcgtttcttcaacccatga
                                               ** * * ****   *      * *

© 1998-2023Legal notice