Dataset for CDS Unclassified of Organism Biomphalaria glabrata

[Download (right click)]

13 sequence(s)

>gnl|bcl2dbcds|A0A182YU05_uncBOK-01 Putative BCL2-related ovarian killer gene OS=[Eukaryota] Biomphalaria glabrata (length=588 residues).
atgaccagaactgtgtttcaggtgtgttgcatttgcaaagattatatcatcaacaaattaactttgagggatctgatgag
cagaaagattggatttactcagaccaactccaagaactctgtacacattattaacgccggcactgctttagaaatgatgt
atccaaggacttattccaatgtgtcaaggaagctctccatgactatgagttcagtaaagattgttcgcacgacgttatct
ctcttcctggagattctctttgaaggatctattacctggggcaaggtggtctcaatgtttactgtggcaggcttgtttgc
agaagaatgcgctagccagggacacgctgacttcgtccaagaagttgttcatgttgttgtggactataccggaagtagcc
tgctgccgtggctcgtgcagcaaggaggatgggtcactaattttattcttttttttcttttcaaggatgcctttccattg
cctggttgcagtcaaaatagtcgtctgagcaagcttagacttttgattgttgcttgcggcgcgacggctgtagctgtttc
cagttcatccattctcgatttttggtga
>gnl|bcl2dbcds|A0A182YU05_uncBOK-02 Putative BCL2-related ovarian killer gene OS=[Eukaryota] Biomphalaria glabrata (length=567 residues).
atgtgtgtgtttatgaccagaactgtgtttcaggtgtgttgcatttgcaaagattatatcatcaacaaattaactttgag
ggatctgatgagcagaaagattggatttactcagaccaactccaagaactctgtacacattattaacgccggcactgctt
tagaaatgatgtatccaaggacttattccaatgtgtcaaggaagctctccatgactatgagttcagtaaagattgttcgc
acgacgttatctctcttcctggagattctctttgaaggatctattacctggggcaaggtggtctcaatgtttactgtggc
aggcttgtttgcagaagaatgcgctagccagggacacgctgacttcgtccaagaagttgttcatgttgttgtggactata
ccggaagtagcctgctgccgtggctcgtgcagcaaggaggatgggatgcctttccattgcctggttgcagtcaaaatagt
cgtctgagcaagcttagacttttgattgttgcttgcggcgcgacggctgtagctgtttccagttcatccattctcgattt
ttggtga
>gnl|bcl2dbcds|A0A182YU44_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Biomphalaria glabrata (length=570 residues).
atgtcgctgaacttgaccccagaaattgtaatgcacgaaaatcatggtgtacttctgacattttttgatgaaagcatgca
aagagatggcattgagaaaactgcagaaatgcagcaactactggactcagaggcggccaaatcgcaaaagatgagactct
acaaagagcatgctcgcaagttgttagtgatagcagatgaaatagacagcaagtccagtgtaacgatgcaagatcttgta
agcaaaattcctcctgatgcagaaagagaaatattaatacaggttgcccaaaaaatactgtcagaagatatcacatgggg
caagattgcagctttgtttttattcacctacaaagtttgtatacgggttatagatggattttctctcatcaaaaatgtca
tcaacataattcttgactttatggcttctcgcgttgtcagttggataattcagaaaggcggatggaaagctattcaagaa
aatacgatcagaccaactatatacaggatcagcattggaattatcttcttgtctgttggtgtaactcttctgttcttgta
tcggaaataa
>gnl|bcl2dbcds|A0A182YU44_uncBAX-02 Putative BCL2-associated X gene OS=[Eukaryota] Biomphalaria glabrata (length=570 residues).
atgtcgctgaacttgaccccagaaattgtaatgcacgaaaatcatggtgtacttctgacattttttgatgaaagcatgca
aagagatggcattgagaaaactgcagaaatgcagcaactactggactcagaggcggccaaatcgcaaaagatgagactct
acaaagagcatgctcgcaagttgttagtgatagcagatgaaatagacagcaagtccagtgtaacgatgcaagatcttgta
agcaaaattcctcctgatgcagaaagagaaatattaatacaggttgcccaaaaaatactgtcagaagatatcacatgggg
caagattgcagctttgtttttattcacctacaaagtttgtatacgggttatagatggattttctctcatcaaaaatgtca
tcaacataattcttgactttatggcttctcgcgttgtcagttggataattcagaaaggcggatggaaagctattcaagaa
aatacgatcagaccaactatatacaggatcagcattggaattatcttcttgtctgttggtgtaactcttctgttcttgta
tcggaaataa
>gnl|bcl2dbcds|A0A182YU44_uncBAX-03 Putative BCL2-associated X gene OS=[Eukaryota] Biomphalaria glabrata (length=570 residues).
atgtcgctgaacttgaccccagaaattgtaatgcacgaaaatcatggtgtacttctgacattttttgatgaaagcatgca
aagagatggcattgagaaaactgcagaaatgcagcaactactggactcagaggcggccaaatcgcaaaagatgagactct
acaaagagcatgctcgcaagttgttagtgatagcagatgaaatagacagcaagtccagtgtaacgatgcaagatcttgta
agcaaaattcctcctgatgcagaaagagaaatattaatacaggttgcccaaaaaatactgtcagaagatatcacatgggg
caagattgcagctttgtttttattcacctacaaagtttgtatacgggttatagatggattttctctcatcaaaaatgtca
tcaacataattcttgactttatggcttctcgcgttgtcagttggataattcagaaaggcggatggaaagctattcaagaa
aatacgatcagaccaactatatacaggatcagcattggaattatcttcttgtctgttggtgtaactcttctgttcttgta
tcggaaataa
>gnl|bcl2dbcds|A0A182YU44_uncBAX-04 Putative BCL2-associated X gene OS=[Eukaryota] Biomphalaria glabrata (length=570 residues).
atgtcgctgaacttgaccccagaaattgtaatgcacgaaaatcatggtgtacttctgacattttttgatgaaagcatgca
aagagatggcattgagaaaactgcagaaatgcagcaactactggactcagaggcggccaaatcgcaaaagatgagactct
acaaagagcatgctcgcaagttgttagtgatagcagatgaaatagacagcaagtccagtgtaacgatgcaagatcttgta
agcaaaattcctcctgatgcagaaagagaaatattaatacaggttgcccaaaaaatactgtcagaagatatcacatgggg
caagattgcagctttgtttttattcacctacaaagtttgtatacgggttatagatggattttctctcatcaaaaatgtca
tcaacataattcttgactttatggcttctcgcgttgtcagttggataattcagaaaggcggatggaaagctattcaagaa
aatacgatcagaccaactatatacaggatcagcattggaattatcttcttgtctgttggtgtaactcttctgttcttgta
tcggaaataa
>gnl|bcl2dbcds|A0A2C9KUF2_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Biomphalaria glabrata (length=564 residues).
atgggaagtatagatcaaagttcaaatgtcacccagttcaaagatagaggagttcggataatcacaagcagacaaacgaa
agcgttactctctacgctggtggcttatcgcatcgggaaaaaaacaagtacccagatgtctctgacaccggaagcgttcg
ctcttcttcttgagatgttctctaaagcgacggacatggtagaagaaagcagtgctacccagtacatcgaaaagttccca
cgagaaggaaaggccacaagcttacgtgaaatagtcagaaacatctttcctaacggagaaatcaattttggtcgcgttct
ggttgttttcagtttggcttacgagatgtgtgtacagttccccgatgacgaggattacattattgaaatcatggagacac
ttgtggatgagtttcttgttgactggatagtggataacggaggctgggagaagctgataatgtcttgccaagctaaaagc
gtaccttttccaaagactaagctagcttgctgcatcgcggcattagcagtgggtggattgcttgtctacaaaagagtttt
gtga
>gnl|bcl2dbcds|A0A2C9KUF2_uncBAX-02 Putative BCL2-associated X gene OS=[Eukaryota] Biomphalaria glabrata (length=474 residues).
atgggaagtatagatcaaagttcaaatgtcacccagttcaaagatagaggagttcggataatcacaagcagacaaacgaa
agcgttactctctacgctggtggcttatcgcatcgggaaaaaaacaagtacccagatgtctctgacaccggaagcgttcg
ctcttcttcttgagatgttctctaaagcgacggacatggtagaagaaagcagtgctacccagtacatcgaaaagttccca
cgagaaggaaaggccacaagcttacgtgaaatagtcagaaacatctttcctaacggagaaatcaattttggtcgcgttct
ggttgttttcagtttggcttacgagatgtgtgtacaggagaagctgataatgtcttgccaagctaaaagcgtaccttttc
caaagactaagctagcttgctgcatcgcggcattagcagtgggtggattgcttgtctacaaaagagttttgtga
>gnl|bcl2dbcds|A0A2C9L178_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Biomphalaria glabrata (length=684 residues).
atgggctcaagtggcaatcctatcaagagattgcttgtccgtagaaactcaaatttaagtccactagttattccttccag
tgatacatcagctccagttgaatctactacaaatcaggaagttaaatctggtcttttgtatgataagcaacaagtgcaag
aagagggcctagagctgttctgtaattttctatatgatcagacttttgaaaagcaagtaaccataatgatttcaaatctc
agtttatggggagtctcacaaggttacagacatagtagctgggccaagaatggggaaaatctgaaggctgtatgcaataa
atttgcttgttcgaaaaaacgaattcaagtgttaaatgaatcacttgagtttgacttgaacatgaggaaagaccagtata
tggaacgacttgaacatttcacagacacagaaaatataacagcagaaaaaatagtgtttatattttttttctgttctgat
gtaatcttacgatgtagtgaaattaacagggacatttttaggcaatactttgagtggactaatgaattcctggcacattc
aatcagcgtttggatatatgaacatggtggatggggtaccgtttttccagagcctgtcaacattttagcaagactaattg
gctttgcatcaatctacaaaagagaaaatcaaattgccacatag
>gnl|bcl2dbcds|A0A2C9L178_uncBAX-02 Putative BCL2-associated X gene OS=[Eukaryota] Biomphalaria glabrata (length=705 residues).
atgggctcaagtggcaatcctatcaagagattgcttgtccgtagaaactcaaatttaagtccactagttattccttccag
tgatacatcagctccagttgaatctactacaaatcaggaagttaaatctggtcttttgtatgataagcaacaagtgcaag
aagagggcctagagctgttctgtaattttctatatgatcagacttttgaaaagcaagtaaccataatgatttcaaatctc
agtttatggggagtctcacaaggttacagacatagtagctgggccaagaatggggaaaatctgaaggctgtatgcaataa
atttgcttgttcgaaaaaacgaattcaagtgttaaatgaatcacttgagtttgacttgaacatgaggaaagaccagtata
tggaacgacttgaacatttcacagacacagaaaatataacagcagaaaaaatagtgtttatattttttttctgttctgat
gtaatcttacgatgtagtgaaattaacagggacatttttaggcaatactttgagtggactaatgaattcctggcacattc
aatcagcgtttggatatatgaacatggtggatggggtaccgtttttccagagcctgtcaacattttagcaagactaattg
gctttgcatcagtaggagtcgctttatttattatctttaagtatttaaaatatagctatttatga
>gnl|bcl2dbcds|A0A2C9L178_uncBAX-03 Putative BCL2-associated X gene OS=[Eukaryota] Biomphalaria glabrata (length=705 residues).
atgggctcaagtggcaatcctatcaagagattgcttgtccgtagaaactcaaatttaagtccactagttattccttccag
tgatacatcagctccagttgaatctactacaaatcaggaagttaaatctggtcttttgtatgataagcaacaagtgcaag
aagagggcctagagctgttctgtaattttctatatgatcagacttttgaaaagcaagtaaccataatgatttcaaatctc
agtttatggggagtctcacaaggttacagacatagtagctgggccaagaatggggaaaatctgaaggctgtatgcaataa
atttgcttgttcgaaaaaacgaattcaagtgttaaatgaatcacttgagtttgacttgaacatgaggaaagaccagtata
tggaacgacttgaacatttcacagacacagaaaatataacagcagaaaaaatagtgtttatattttttttctgttctgat
gtaatcttacgatgtagtgaaattaacagggacatttttaggcaatactttgagtggactaatgaattcctggcacattc
aatcagcgtttggatatatgaacatggtggatggggtaccgtttttccagagcctgtcaacattttagcaagactaattg
gctttgcatcagtaggagtcgctttatttattatctttaagtatttaaaatatagctatttatga
>gnl|bcl2dbcds|A0A2C9LR70_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Biomphalaria glabrata (length=570 residues).
atggcgctgaccccagaaattgtagagcaagaaacccaaagtgtactttttacattttttgatgaacgcatgcaaagaga
tggcattgagaaaacagcagaaatgcagcaactactggtctcagaggtgaccggatcacaaaacatggccacctacaaac
aatatgcaagtatggtgttattagttgcggatgaaatagatagcaaatacaatacaaagatacaagatcttgcaagcaca
gttcctccgaatgcagaaagggaaataataaaacaggtagctgaagaaatactctcaggaggtatcacatggggcaagat
tgcaactttgtttttattcacctacaaagtttgtatacgggttttagacagatttcctctaatcacaaatatcatcaaca
tagttcttgactttatggctgttcgtgttgtccattggataattcagaaaggcggatggaaatccattcaagaaaacatg
atcagacctctaccagatatattcaggatcagcctcggggtagttttcttgtctgttggtgtatttcttttgttctggta
tcggaaataa
>gnl|bcl2dbcds|A0A2C9LR70_uncBAX-02 Putative BCL2-associated X gene OS=[Eukaryota] Biomphalaria glabrata (length=570 residues).
atggcgctgaccccagaaattgtagagcaagaaacccaaagtgtactttttacattttttgatgaacgcatgcaaagaga
tggcattgagaaaacagcagaaatgcagcaactactggtctcagaggtgaccggatcacaaaacatggccacctacaaac
aatatgcaagtatggtgttattagttgcggatgaaatagatagcaaatacaatacaaagatacaagatcttgcaagcaca
gttcctccgaatgcagaaagggaaataataaaacaggtagctgaagaaatactctcaggaggtatcacatggggcaagat
tgcaactttgtttttattcacctacaaagtttgtatacgggttttagacagatttcctctaatcacaaatatcatcaaca
tagttcttgactttatggctgttcgtgttgtccattggataattcagaaaggcggatggaaatccattcaagaaaacatg
atcagacctctaccagatatattcaggatcagcctcggggtagttttcttgtctgttggtgtatttcttttgttctggta
tcggaaataa
© 1998-2023Legal notice