Dataset for CDS BCL-2-like of organism Cricetulus griseus

[Download (right click)] [Alignment] [Repertoires]

8 sequence(s)

>gnl|bcl2dbcds|A0A8C2LQI3_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Cricetulus griseus GN=BCL2A1 (length=507 residues).
atgactgactgtgagttcatgtacatccactcgctggctgaggactatcttcagtatgtcctgaaggtacctacttttga
atctgctccaagcaaaacatccagggtgctacaaagagttgcttcctcagttcaaaaagaagtcgaaaagaatctgaaac
tatacttggatgattttgatgtgagatccatcgacactgccagaacaatattcaatcaagtgatggaaaaagaatttgaa
gatggcatcattaactgggggaggattgtgactgtatttgcctttgggggtgttctcctcaaaaaacttgcacaagagca
gattggcttggatgtgggtgcttacaagcaagtttccaattttgtggctgaattcataatgaataacacagcagagtgga
tacgtcagaatggaggctgggaagatggcttcatgaagaagtttgaacctaaatctggctgggtgacttttctggaaacg
atagggcagatctgggaaatgctcttt
>gnl|bcl2dbcds|A0A8C2MG79_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cricetulus griseus GN=MCL-1 (length=1023 residues).
atgtttggcctgcggagaaacgcggtgatcggcctgaacctgtactgcggcggcgccagcctgggcgcgggcggcggctc
tccggccggggcgcgcctcacggccgaggaggccaaggcgcggcgcgaggggggaggggaggccggcctgctgcccggcg
cgcgggtggccgtgcggccgccgcccgtgggcgccgaggaccccgacgtcaccgcgtcggccgagaggcggctgctccgg
tcgcccggcctcctcgccgtgccgcccgaggagatggccgcgccggcctccgcctcctcctccaccgccgccgccgccgc
catcatgtcccccgaggaggagctggacggctgcgagccggaggcgctcggcaagcggccggccgtgctgcccctgctgg
agcgcgtgagcagcgaggcggctaagaacccgggcgccgccggctcgctgccctccacgccgccgtcggccgaggaggag
gaggacgagctgtaccgccagtcgctcgagatcatctcgcgctacctccgggagcaggcggccggcgtcaaggacgcgaa
gccgctgggcgaggcgggcgcggcgggccggagggcgctggagaccctgcggcgcgtgggcgacggcgtgcagcgcaacc
acgagacggccttccagggcatgcttcggaaaatggacattaaaaacgaagacgatgtcaaatctttttctcgagtgatg
gtccatgttttcaaggatggcataacaaactggggcaggattgtgactcttatttcttttggtgcctatgtggccaaaca
cttgaagagcataaaccaggaaagctgcatcgaacccttagcagaaagtatcacagatgttcttgtaaggacaaaacggg
actggcttgtcaaacaaagaggctgggatgggtttgtggagttcttccacgtacaggacctagaaggcggcatcagaaat
gtgctgctggcttttgcgggtgttgctggagtaggggctggtctggcatatctaataagatag
>gnl|bcl2dbcds|A0A8C2MG79_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cricetulus griseus GN=MCL-1 (length=879 residues).
atgtttggcctgcggagaaacgcggtgatcggcctgaacctgtactgcggcggcgaccccgacgtcaccgcgtcggccga
gaggcggctgctccggtcgcccggcctcctcgccgtgccgcccgaggagatggccgcgccggcctccgcctcctcctcca
ccgccgccgccgccgccatcatgtcccccgaggaggagctggacggctgcgagccggaggcgctcggcaagcggccggcc
gtgctgcccctgctggagcgcgtgagcagcgaggcggctaagaacccgggcgccgccggctcgctgccctccacgccgcc
gtcggccgaggaggaggaggacgagctgtaccgccagtcgctcgagatcatctcgcgctacctccgggagcaggcggccg
gcgtcaaggacgcgaagccgctgggcgaggcgggcgcggcgggccggagggcgctggagaccctgcggcgcgtgggcgac
ggcgtgcagcgcaaccacgagacggccttccagggcatgcttcggaaaatggacattaaaaacgaagacgatgtcaaatc
tttttctcgagtgatggtccatgttttcaaggatggcataacaaactggggcaggattgtgactcttatttcttttggtg
cctatgtggccaaacacttgaagagcataaaccaggaaagctgcatcgaacccttagcagaaagtatcacagatgttctt
gtaaggacaaaacgggactggcttgtcaaacaaagaggctgggatgggtttgtggagttcttccacgtacaggacctaga
aggcggcatcagaaatgtgctgctggcttttgcgggtgttgctggagtaggggctggtctggcatatctaataagatag
>gnl|bcl2dbcds|A0A8C2MSB6_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Cricetulus griseus GN=BCL2L10 (length=522 residues).
atggacgacccgctgctggaacgcactagacggctgctgactgactacttgatgttctgcgcacgggagccagatgaacc
cgagccactgcccaggtcggtcgaggccgccttgctgcgctccgtggcagagcagttccaagaacagcaccacttttttt
tctcctccttctacggctacaagggcaaccgtgtgctgctgatgacacagatggcagatgcggtgctctctgatagcgaa
ggcttcaactggggccgccttgtgatgctcttggccttcgcggggacaattgtgagtcaagagcagataaatgtgcttct
agactgccaactcatagtggacttgctgtgcgatcggatcctgggacagcatcgctcctggctggaggctcacggtggct
gggatggcttttaccacttcttttcgagccacttaccactcgatttttggaggagtctgctgatcaagacttttctatac
tgggtctttgcaacggccatgctgtttatctggaaaagatta
>gnl|bcl2dbcds|B2Z3Z4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cricetulus griseus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctagtggttgactttctctcctacaagttctcccagaaaggatacagctggagtcagtt
tagtgatgtcgaagagaacaggactgaggccccagaaggaactgaatcagagagggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtaaatggagccactggccacagcagcagtttggatgcacgggaggtg
atccccatggcagccgtaaagcaagcgctgagagaggccggcgatgagtttgagctgcggtaccggcgggcgttcagtga
tctaacatcccagcttcatataaccccagggactgcatatcaaagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggtggagccctctgtgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaagttggatggccacctacctgaatgaccacctagagccttggatccaggacaacggcgg
ctgggacactttcgtggaactctacggaaacaatgcagcagctgagagccggaaaggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctctctcttcagtcggaagtga
>gnl|bcl2dbcds|G3HEA7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cricetulus griseus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctagtggttgactttctctcctacaagctctcccagaaaggatacagctggagtcagtt
tagtgatgtcgaagagaacaggactgaggccccagaaggaactgaatcagagagggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtaaatggagccactggccacagcagcagtttggatgcacgggaggtg
atccccatggcagccgtaaagcaagcgctgagagaggccggcgatgagtttgagctgcggtaccggcgggcgttcagtga
tctaacatcccagcttcatataaccccagggactgcatatcaaagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggtggagccctctgtgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaagttggatggccacctacctgaatgaccacctagagccttggatccaggacaacggcgg
ctgggacactttcgtggaactctacggaaacaatgcagcagctgagagccggaaaggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctctctcttcagtcggaagtga
>gnl|bcl2dbcds|G3HRE9_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Cricetulus griseus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcagccccagacacacgggctctagtggctgactttgtaggctataagctgaggcagaagggtta
tgtctgtggagctggccctggggagggcccagcagctgacccgctgcaccaagccatgcgggctgctggagacgagtttg
agacacgcttccggcgcaccttctctgacctggccgctcagctacacgtgaccccaggctcagcccagcaacgcttcacc
caggtttccgacgaacttttccaagggggccccaattggggccgtcttgtggcattctttgtctttggggctgccctgtg
tgctgaaagtgtcaacaaagaaatggagccacttgtgggacaagtgcaggattggatggtgacctacctggagacacgcc
tggctgactggatccacagcagtgggggctgggccgagttcacagctctgtacggggacggggccctggaggaggcacgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgactggggccgtggcactgggggccctggtcactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|Q9JJV8_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cricetulus griseus GN=BCL-2 (length=711 residues).
atggctcaagctgggagaacagggtatgataaccgagagatcgtgatgaagtacatccattataagctgtcacagagggg
ctacgagtgggatgtgggagatgtggacgccgcgcccctgggcgccgcccccacccctggcatcttctccttccagcctg
agagcaacccaacgcccgctgtgcaccgggacatggctgccaggacatcgccactaaggcccatagtcgccaccactggg
cctacccttagccccgtgccacctgtggtccacctgaccctccgccgggctggggatgacttctcccgtcgctaccgtcg
cgacttcgcggagatgtccagtcagctgcacctgacgcccttcaccgcgaggggacgctttgctacggtggtggaggaac
tcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
agggagatgtcacccctggtggacaacatcgccctgtggatgaccgagtacctgaaccggcatctgcacacctggatcca
ggataacggaggctgggacgcatttgtggaactgtacggccccagtgtgaggcctctgtttgatttctcttggctgtctc
tgaagaccctgctcagcctggccctggtcggggcctgcatcactctgggtacctacctgggccacaagtga
© 1998-2022Legal notice