Dataset for CDS BCL-2-like of organism Cricetulus griseus

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G3HRE9_BCL2L2-01        atggcgaccccagcct-------cagccccagacacacgggctctagtgg
Q9JJV8_BCL2-01          atgg----ctcaagctgggagaacagggtatgataaccgagagatcgtga
B2Z3Z4_BCL2L1-01        atg----------------------tctcagagcaaccgggagctagtgg
G3HEA7_BCL2L1-01        atg----------------------tctcagagcaaccgggagctagtgg
A0A3L7HT14_BCL2A1-      atg----------------------------------------------g
A0A3L7HT14_BCL2A1-      atgattaccccttcgt---------tgtcaagccatctttggcttagttg
A0A3L7HT14_BCL2A1-      atgattaccccttcgt---------tgtcaagccatctttggcttagttg
                        ***                                               

G3HRE9_BCL2L2-01        c---------tgactttgtaggctataag-ctgaggcagaagggttatgt
Q9JJV8_BCL2-01          t---------gaagtacatccattataag-ctgtcacagaggggctacga
B2Z3Z4_BCL2L1-01        t---------tgactttctctcctacaag-ttctcccagaaaggatacag
G3HEA7_BCL2L1-01        t---------tgactttctctcctacaag-ctctcccagaaaggatacag
A0A3L7HT14_BCL2A1-      cctgt----------------gcgccaatgctagtccacagaggcc----
A0A3L7HT14_BCL2A1-      cctctttgactggacttggcagctccagt-ctgctctgccaaggacaatg
A0A3L7HT14_BCL2A1-      cctctttgactggacttggcagctccagt-ctgctctgccaaggacaatg
                                                  *    *          **      

G3HRE9_BCL2L2-01        ctgtggagctgg-----------------ccct-----------------
Q9JJV8_BCL2-01          gtgggatgtgggagatgtggacgccgcgcccct-----------------
B2Z3Z4_BCL2L1-01        ctgga--gtcag-tttagtgatgtcga-----------------------
G3HEA7_BCL2L1-01        ctgga--gtcag-tttagtgatgtcga-----------------------
A0A3L7HT14_BCL2A1-      --------------------acgccccctccct-----------------
A0A3L7HT14_BCL2A1-      actgactgtgag-ttcatgtacatccactcgctggctgaggactatcttc
A0A3L7HT14_BCL2A1-      actgactgtgag-ttcatgtacatccactcgctggctgaggactatcttc
                                                                          

G3HRE9_BCL2L2-01        --------------------------------------------------
Q9JJV8_BCL2-01          --------------------------------------------------
B2Z3Z4_BCL2L1-01        -------------------------------------agagaacaggact
G3HEA7_BCL2L1-01        -------------------------------------agagaacaggact
A0A3L7HT14_BCL2A1-      ---------------------------------ccccacg----------
A0A3L7HT14_BCL2A1-      agtatgtcctgaaggtacctacttttgaatctgctccaagcaaaacatcc
A0A3L7HT14_BCL2A1-      agtatgtcctgaaggtacctacttttgaatctgctccaagcaaaacatcc
                                                                          

G3HRE9_BCL2L2-01        --------------------------------------------------
Q9JJV8_BCL2-01          --------------------------------------------------
B2Z3Z4_BCL2L1-01        gaggccccagaaggaactgaatca--------------------------
G3HEA7_BCL2L1-01        gaggccccagaaggaactgaatca--------------------------
A0A3L7HT14_BCL2A1-      ------------------gcgtcc--------------------------
A0A3L7HT14_BCL2A1-      agggtgctacaaagagttgcttcctcagttcaaaaagaagtcgaaaagaa
A0A3L7HT14_BCL2A1-      agggtgctacaaagagttgcttcctcagttcaaaaagaagtcgaaaagaa
                                                                          

G3HRE9_BCL2L2-01        ------------------------------ggggagggccc---------
Q9JJV8_BCL2-01          ------------------------------gggcgccgcccccacccctg
B2Z3Z4_BCL2L1-01        ----------------------------gagagggagacccccagtgcca
G3HEA7_BCL2L1-01        ----------------------------gagagggagacccccagtgcca
A0A3L7HT14_BCL2A1-      ------------------------------gagggcgatgggcgtggccg
A0A3L7HT14_BCL2A1-      tctgaaactatacttggatgattttgatgtgagatccatcgacactgcca
A0A3L7HT14_BCL2A1-      tctgaaactatacttggatgattttgatgtgagatccatcgacactgcca
                                                      * *                 

G3HRE9_BCL2L2-01        -----------------------agcagc-----tga---cccgc--tgc
Q9JJV8_BCL2-01          gcatcttctccttccagcctgagagcaac-----ccaacgcccgctgtgc
B2Z3Z4_BCL2L1-01        tcaatggcaacccatc-----ctggcacc-----tggcggacagccccgc
G3HEA7_BCL2L1-01        tcaatggcaacccatc-----ctggcacc-----tggcggacagccccgc
A0A3L7HT14_BCL2A1-      g-ggcggtactt-gccacgtgatggcggcgg---tggcagcaagcagcgc
A0A3L7HT14_BCL2A1-      g-aacaatattcaatcaagtgatggaaaaagaatttgaagatggcatcat
A0A3L7HT14_BCL2A1-      g-aacaatattcaatcaagtgatggaaaaagaatttgaagatggcatcat
                                                *                  **     

G3HRE9_BCL2L2-01        accaag-------------------ccatg--------------------
Q9JJV8_BCL2-01          accggg-------------------acatggctgc---------------
B2Z3Z4_BCL2L1-01        ggtaaatggagccactgg-------ccacagcagcagtttgga-------
G3HEA7_BCL2L1-01        ggtaaatggagccactgg-------ccacagcagcagtttgga-------
A0A3L7HT14_BCL2A1-      --caagcggagcctgcgggccgag-ctgaagcagcgtttgcgggcctt--
A0A3L7HT14_BCL2A1-      --taactgggg---gaggattgtgactgtatttgcctttgggggtgttct
A0A3L7HT14_BCL2A1-      --taactgggg---gaggattgtgactgtatttgcctttgggggtgttct
                                                                          

G3HRE9_BCL2L2-01        --------------------------------------------------
Q9JJV8_BCL2-01          ----------------caggacatcgccactaaggcccatagtcgccacc
B2Z3Z4_BCL2L1-01        ------------tgcacgggaggtgatccccatggcagccg------taa
G3HEA7_BCL2L1-01        ------------tgcacgggaggtgatccccatggcagccg------taa
A0A3L7HT14_BCL2A1-      -----------------gagcgcgga--ggaacggctgcgg---------
A0A3L7HT14_BCL2A1-      cctcaaaaaacttgcacaagagcagattggcttggatgtgggtgcttaca
A0A3L7HT14_BCL2A1-      cctcaaaaaacttgcacaagagcagattggcttggatgtgggtgcttaca
                                                                          

G3HRE9_BCL2L2-01        --cgggct------------------------------------------
Q9JJV8_BCL2-01          actgggcctacccttagccccgtgccacctgtggtccacctgaccctccg
B2Z3Z4_BCL2L1-01        agcaagc-------------------------------------gctgag
G3HEA7_BCL2L1-01        agcaagc-------------------------------------gctgag
A0A3L7HT14_BCL2A1-      ---cagtctc--------------acctcctcacg---------------
A0A3L7HT14_BCL2A1-      agcaagtttccaattttgtggctgaattcataatgaataacacagcagag
A0A3L7HT14_BCL2A1-      agcaagtttccaattttgtggctgaattcataatgaataacacagcagag
                             *                                            

G3HRE9_BCL2L2-01        ----gctggagacgagtttgagacacgcttccggcgcaccttctct----
Q9JJV8_BCL2-01          ccgggctggggatgacttctcccgtcgctaccgtcgcgacttcgcg----
B2Z3Z4_BCL2L1-01        agaggccggcgatgagtttgagctgcggtaccggcgggcgttcagt----
G3HEA7_BCL2L1-01        agaggccggcgatgagtttgagctgcggtaccggcgggcgttcagt----
A0A3L7HT14_BCL2A1-      ---------ca--gaa----------ggtgattgctcacagtcagtatca
A0A3L7HT14_BCL2A1-      tggatacgtca--gaatggaggctg-ggtgattgctcacagtcagtatca
A0A3L7HT14_BCL2A1-      tggatacgtca--gaatggaggctg-gg----------------------
                                     **           *                       

G3HRE9_BCL2L2-01        -----------------------------------gacctggccgctcag
Q9JJV8_BCL2-01          -----------------------------------gagatgtccagtcag
B2Z3Z4_BCL2L1-01        -----------------------------------gatctaacatcccag
G3HEA7_BCL2L1-01        -----------------------------------gatctaacatcccag
A0A3L7HT14_BCL2A1-      aaattccaaaagaatttccatctttttgagcatgcaagatgaaattgaga
A0A3L7HT14_BCL2A1-      aaattccaaaagaatttccatctttttgagcatgcaagatgaaattgaga
A0A3L7HT14_BCL2A1-      -----------------------------------aagatgg--------
                                                            *  *          

G3HRE9_BCL2L2-01        ctacacgtgaccccaggctcagcccagcaacgcttcaccc-aggtttccg
Q9JJV8_BCL2-01          ctgcacctgacgcccttcaccgcgaggggacgctttgcta-cggtggtgg
B2Z3Z4_BCL2L1-01        cttcatataaccccagggactgcatatcaaagctttgaac-aggtagtga
G3HEA7_BCL2L1-01        cttcatataaccccagggactgcatatcaaagctttgaac-aggtagtga
A0A3L7HT14_BCL2A1-      cagaagagatcatcaaggac----------attttcaaacaaggcaaaat
A0A3L7HT14_BCL2A1-      cagaagagatcatcaaggac----------attttcaaacaaggcaaaat
A0A3L7HT14_BCL2A1-      ----------cttcatgaag----------aagtttgaac----ctaaat
                                  *  *                   **               

G3HRE9_BCL2L2-01        acg--------------aacttttcca------------agggggcccca
Q9JJV8_BCL2-01          agg--------------aactcttcag------------ggatggggtga
B2Z3Z4_BCL2L1-01        atg--------------aactcttccg------------ggatggggtaa
G3HEA7_BCL2L1-01        atg--------------aactcttccg------------ggatggggtaa
A0A3L7HT14_BCL2A1-      ctgcttcatccctcggtaccggttccagagcaatcacatggacatggtga
A0A3L7HT14_BCL2A1-      ctgcttcatccctcggtaccggttccagagcaatcacatggacatggtga
A0A3L7HT14_BCL2A1-      ctg-------gctgggtgacttttc-------------tggaaacgatag
                          *                *  ***               *         

G3HRE9_BCL2L2-01        -attggggccgtcttgtggcattctttgtctttgggg-------------
Q9JJV8_BCL2-01          -actgggggaggattgtggccttctttgagttcggtg-------------
B2Z3Z4_BCL2L1-01        -actggggtcgcattgtggcctttttctccttcggtg-------------
G3HEA7_BCL2L1-01        -actggggtcgcattgtggcctttttctccttcggtg-------------
A0A3L7HT14_BCL2A1-      gattagcatcacctgaagagatctctttacttcccaa--aacatcctgga
A0A3L7HT14_BCL2A1-      gattagcatcacctgaagagatctctttacttcccaa--aacatcctgga
A0A3L7HT14_BCL2A1-      ggcag-----atctgggaaatgctcttttctcctcaagcaaca-------
                                     *           *    *                   

G3HRE9_BCL2L2-01        --------ctgccctgtgtgctgaaagtgtcaacaaagaaatggagccac
Q9JJV8_BCL2-01          --------gggtcatgtgtgtggagagcgtcaacagggagatgtcacccc
B2Z3Z4_BCL2L1-01        --------gagccctctgtgtggaaagcgtagacaaggagatgcaggtat
G3HEA7_BCL2L1-01        --------gagccctctgtgtggaaagcgtagacaaggagatgcaggtat
A0A3L7HT14_BCL2A1-      atattcatcagcccgctgagggagatgc-tcgagaggaggccttatccac
A0A3L7HT14_BCL2A1-      atattcatcagcccgctgagggagatgc-tcgagaggaggccttatccac
A0A3L7HT14_BCL2A1-      ------------ctactg--------gc-cagagag--------------
                                    *   **        *     * *               

G3HRE9_BCL2L2-01        ttgtgggacaagtgcaggat-------t---ggatggtgacctacctgg-
Q9JJV8_BCL2-01          tggtgg-------acaacatcgccctgt---ggatgaccgagtacctga-
B2Z3Z4_BCL2L1-01        tggtga-------gtcggatcgcaagtt---ggatggccacctacctga-
G3HEA7_BCL2L1-01        tggtga-------gtcggatcgcaagtt---ggatggccacctacctga-
A0A3L7HT14_BCL2A1-      tggtgg-------acttgacctcatcttcttgccaggccttgggtttgac
A0A3L7HT14_BCL2A1-      tggtgg-------acttgacctcatcttcttgccaggccttgggtttgac
A0A3L7HT14_BCL2A1-      -----------------gaccctggctcc---------------ttcgac
                                          *                            *  

G3HRE9_BCL2L2-01        ----agacacgcctggctgactggatccacagcagtgggggctgggccga
Q9JJV8_BCL2-01          ----accggcatctgcacacctggatccaggataacggaggctgggacgc
B2Z3Z4_BCL2L1-01        ----atgaccacctagagccttggatccaggacaacggcggctgggacac
G3HEA7_BCL2L1-01        ----atgaccacctagagccttggatccaggacaacggcggctgggacac
A0A3L7HT14_BCL2A1-      aaagatggcaacc----ggctaggg--cggggcaagggctactatgacac
A0A3L7HT14_BCL2A1-      aaagatggcaacc----ggctaggg--cggggcaagggctactatgacac
A0A3L7HT14_BCL2A1-      aatggtgaccatc----acttag---------------------------
                                    *         *                           

G3HRE9_BCL2L2-01        gttcacagctctgtacggggacggggc-----cctggaggaggcacggcg
Q9JJV8_BCL2-01          atttgtggaactgtac--------ggc-----cccag----tgtgaggcc
B2Z3Z4_BCL2L1-01        tttcgtggaactctacggaaacaatgcagcagctgagagccggaaaggcc
G3HEA7_BCL2L1-01        tttcgtggaactctacggaaacaatgcagcagctgagagccggaaaggcc
A0A3L7HT14_BCL2A1-      ctacttgaagcgctgtg-------tgcagcaccaggaagt---gaagccc
A0A3L7HT14_BCL2A1-      ctacttgaagcgctgtg-------tgcagcaccaggaagt---gaagccc
A0A3L7HT14_BCL2A1-      -tactt------ccatt-------tgcaa---------------------
                         *                       **                       

G3HRE9_BCL2L2-01        tctgcgggaggggaactgggcatcagtgaggacagtgctgactggg----
Q9JJV8_BCL2-01          tctgtttgatttctcttggctgtctctgaagaccctgctcagcctg----
B2Z3Z4_BCL2L1-01        -------------------------aggagcgcttcaaccgctggttcct
G3HEA7_BCL2L1-01        -------------------------aggagcgcttcaaccgctggttcct
A0A3L7HT14_BCL2A1-      tacacc---ttggctttggctttcaaagagcagatctgcccccaggtccc
A0A3L7HT14_BCL2A1-      tacacc---ttggctttggctttcaaagagcagatctgcccccaggtccc
A0A3L7HT14_BCL2A1-      -acaac---tcagc------------------------------------
                                                                          

G3HRE9_BCL2L2-01        -------------gccgtggcactgggggccctggtcactgtaggggcct
Q9JJV8_BCL2-01          -------------gccctgg---tcggggcctgcatcactctgggtacct
B2Z3Z4_BCL2L1-01        gacg---------ggcatgactgtggctggtgtggttctgctgggctctc
G3HEA7_BCL2L1-01        gacg---------ggcatgactgtggctggtgtggttctgctgggctctc
A0A3L7HT14_BCL2A1-      agtggatgagcatgacatgaaggtagatgaagtcctttatgaagactgcc
A0A3L7HT14_BCL2A1-      agtggatgagcatgacatgaaggtagatgaagtcctttatgaagactgcc
A0A3L7HT14_BCL2A1-      ------------tgacagga------------------------------
                                     * *  *                               

G3HRE9_BCL2L2-01        -----tttttgctagcaagtga
Q9JJV8_BCL2-01          -----acctgggccacaagtga
B2Z3Z4_BCL2L1-01        -----tcttcagtcggaagtga
G3HEA7_BCL2L1-01        -----tcttcagtcggaagtga
A0A3L7HT14_BCL2A1-      cagcatcttaa-----------
A0A3L7HT14_BCL2A1-      cagcatcttaa-----------
A0A3L7HT14_BCL2A1-      ------cttaa-----------
                                *             

© 1998-2022Legal notice