Dataset for CDS BCL-2-like of organism Cricetulus griseus

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q9JJV8_BCL2-01          atggctcaagctgggagaacagggtatgataaccgagagatcgtgat---
G3HEA7_BCL2L1-01        atg-------------tctcagagcaa-----ccgggagctagtggt---
G3HEA7_BCL2L1-02        atg-------------tctcagagcaa-----ccgggagctagtggt---
B2Z3Z4_BCL2L1-01        atg-------------tctcagagcaa-----ccgggagctagtggt---
A0A3L7HT14_BCL2A1-      atg------------------------------------------gcctg
A0A3L7HT14_BCL2A1-      atgattaccccttcgttgtcaagccat-----ctttggcttagttgcctc
A0A3L7HT14_BCL2A1-      atgattaccccttcgttgtcaagccat-----ctttggcttagttgcctc
                        ***                                               

Q9JJV8_BCL2-01          ------gaagtacatccattataag-ctgtcacagaggggctacgagtgg
G3HEA7_BCL2L1-01        ------tgactttctctcctacaag-ctctcccagaaaggatacagctgg
G3HEA7_BCL2L1-02        ------tgactttctctcctacaag-ctctcccagaaaggatacagctgg
B2Z3Z4_BCL2L1-01        ------tgactttctctcctacaag-ttctcccagaaaggatacagctgg
A0A3L7HT14_BCL2A1-      t----------------gcgccaatgctagtccacagaggcc--------
A0A3L7HT14_BCL2A1-      tttgactggacttggcagctccagt-ctgctctgccaaggacaatgactg
A0A3L7HT14_BCL2A1-      tttgactggacttggcagctccagt-ctgctctgccaaggacaatgactg
                                              *    *          **          

Q9JJV8_BCL2-01          gatgtgggagatgtggacgccgcgcccctgggcgc---------------
G3HEA7_BCL2L1-01        a--gtcag-tttagtgatgtcga---------------------------
G3HEA7_BCL2L1-02        a--gtcag-tttagtgatgtcga---------------------------
B2Z3Z4_BCL2L1-01        a--gtcag-tttagtgatgtcga---------------------------
A0A3L7HT14_BCL2A1-      ----------------acgccccctccct---------------------
A0A3L7HT14_BCL2A1-      actgtgag-ttcatgtacatccactcgctggctgaggactatcttcagta
A0A3L7HT14_BCL2A1-      actgtgag-ttcatgtacatccactcgctggctgaggactatcttcagta
                                        *   *                             

Q9JJV8_BCL2-01          -----------------------------------------cgcccccac
G3HEA7_BCL2L1-01        ---------------------------------agagaacaggactgagg
G3HEA7_BCL2L1-02        ---------------------------------agagaacaggactgagg
B2Z3Z4_BCL2L1-01        ---------------------------------agagaacaggactgagg
A0A3L7HT14_BCL2A1-      -----------------------------ccccacg--------------
A0A3L7HT14_BCL2A1-      tgtcctgaaggtacctacttttgaatctgctccaagcaaaacatccaggg
A0A3L7HT14_BCL2A1-      tgtcctgaaggtacctacttttgaatctgctccaagcaaaacatccaggg
                                                                          

Q9JJV8_BCL2-01          ccctggcatcttctccttcc------------------------------
G3HEA7_BCL2L1-01        ccccagaaggaactgaatca------------------------------
G3HEA7_BCL2L1-02        ccccagaaggaactgaatca------------------------------
B2Z3Z4_BCL2L1-01        ccccagaaggaactgaatca------------------------------
A0A3L7HT14_BCL2A1-      --------------gcgtcc------------------------------
A0A3L7HT14_BCL2A1-      tgctacaaagagttgcttcctcagttcaaaaagaagtcgaaaagaatctg
A0A3L7HT14_BCL2A1-      tgctacaaagagttgcttcctcagttcaaaaagaagtcgaaaagaatctg
                                         **                               

Q9JJV8_BCL2-01          ---------------------agcctgagagcaacc--caacgcccgctg
G3HEA7_BCL2L1-01        ------------------------gagagggagacccccagtgccatcaa
G3HEA7_BCL2L1-02        ------------------------gagagggagacccccagtgccatcaa
B2Z3Z4_BCL2L1-01        ------------------------gagagggagacccccagtgccatcaa
A0A3L7HT14_BCL2A1-      --------------------------gagggcgatgggcgtggccgg-gg
A0A3L7HT14_BCL2A1-      aaactatacttggatgattttgatgtgagatccatcgacactgccag-aa
A0A3L7HT14_BCL2A1-      aaactatacttggatgattttgatgtgagatccatcgacactgccag-aa
                                                  ***    *    *   ***     

Q9JJV8_BCL2-01          tg------caccgggacatggc--------tgccag--gacatcgc---c
G3HEA7_BCL2L1-01        tggcaacccatc-----ctggcacc-----tggcggacagccccgcggta
G3HEA7_BCL2L1-02        tggcaacccatc-----ctggcacc-----tggcggacagccccgcggta
B2Z3Z4_BCL2L1-01        tggcaacccatc-----ctggcacc-----tggcggacagccccgcggta
A0A3L7HT14_BCL2A1-      cggtactt-gccacgtgatggcggcgg---tggcagcaagcagcgc--ca
A0A3L7HT14_BCL2A1-      caatattcaatcaagtgatggaaaaagaatttgaagatggcatcat--ta
A0A3L7HT14_BCL2A1-      caatattcaatcaagtgatggaaaaagaatttgaagatggcatcat--ta
                                   *      ***         *    *    *  *      

Q9JJV8_BCL2-01          actaaggc-------------ccatagtcgccaccactgggcctaccctt
G3HEA7_BCL2L1-01        aatggagccactgg-------ccacagcagcagtttgga-----------
G3HEA7_BCL2L1-02        aatggagccactgg-------ccacagcagcagtttgga-----------
B2Z3Z4_BCL2L1-01        aatggagccactgg-------ccacagcagcagtttgga-----------
A0A3L7HT14_BCL2A1-      agcggagcctgcgggccgag-ctgaagcagcgtttgcgggcctt------
A0A3L7HT14_BCL2A1-      actgggg---gaggattgtgactgtatttgcctttgggggtgttctcctc
A0A3L7HT14_BCL2A1-      actgggg---gaggattgtgactgtatttgcctttgggggtgttctcctc
                        *     *              *   *   **                   

Q9JJV8_BCL2-01          agccccgtgccacctgtggtccacctgaccctccgccgggctgggg----
G3HEA7_BCL2L1-01        --------tgcacgggag------gtga---tccccatggcagccg----
G3HEA7_BCL2L1-02        --------tgcacgggag------gtga---tccccatggcagccg----
B2Z3Z4_BCL2L1-01        --------tgcacgggag------gtga---tccccatggcagccg----
A0A3L7HT14_BCL2A1-      -------------gagcg------cgga-----ggaacggctgcgg----
A0A3L7HT14_BCL2A1-      aaaaaacttgcacaagag------caga---ttggcttggatgtgggtgc
A0A3L7HT14_BCL2A1-      aaaaaacttgcacaagag------caga---ttggcttggatgtgggtgc
                                       * *        **          **  *  *    

Q9JJV8_BCL2-01          ----------------------atgacttctcccgtcgctaccgtcgcga
G3HEA7_BCL2L1-01        --taaagcaagc-------------------------------------g
G3HEA7_BCL2L1-02        --taaagcaagc-------------------------------------g
B2Z3Z4_BCL2L1-01        --taaagcaagc-------------------------------------g
A0A3L7HT14_BCL2A1-      --------cagtctc--------------acctcctcacg----------
A0A3L7HT14_BCL2A1-      ttacaagcaagtttccaattttgtggctgaattcataatgaataacacag
A0A3L7HT14_BCL2A1-      ttacaagcaagtttccaattttgtggctgaattcataatgaataacacag
                                                                          

Q9JJV8_BCL2-01          cttcgcggagatgtcc--------agtcagctgcacctgacgcccttca-
G3HEA7_BCL2L1-01        ctgagagaggccggcgatgagtttgagctgcggtaccggcgggcgttcag
G3HEA7_BCL2L1-02        ctgagagaggccggcgatgagtttgagctgcggtaccggcgggcgttcag
B2Z3Z4_BCL2L1-01        ctgagagaggccggcgatgagtttgagctgcggtaccggcgggcgttcag
A0A3L7HT14_BCL2A1-      --------------ca--gaa----------ggtgattgctcacagtcag
A0A3L7HT14_BCL2A1-      cagagtggatacgtca--gaatggaggctg-ggtgattgctcacagtcag
A0A3L7HT14_BCL2A1-      cagagtggatacgtca--gaatggaggctg-gg-----------------
                                      *                 *                 

Q9JJV8_BCL2-01          --------------------------------------------------
G3HEA7_BCL2L1-01        t---------------------------------------gatctaacat
G3HEA7_BCL2L1-02        t---------------------------------------gatctaacat
B2Z3Z4_BCL2L1-01        t---------------------------------------gatctaacat
A0A3L7HT14_BCL2A1-      tatcaaaattccaaaagaatttccatctttttgagcatgcaagatgaaat
A0A3L7HT14_BCL2A1-      tatcaaaattccaaaagaatttccatctttttgagcatgcaagatgaaat
A0A3L7HT14_BCL2A1-      ----------------------------------------aagatgg---
                                                                          

Q9JJV8_BCL2-01          ---------------ccgcgagggg----------acgctttgctacggt
G3HEA7_BCL2L1-01        cccagcttcatataaccccagggactgcatatcaaagctttgaac-aggt
G3HEA7_BCL2L1-02        cccagcttcatataaccccagggactgcatatcaaagctttgaac-aggt
B2Z3Z4_BCL2L1-01        cccagcttcatataaccccagggactgcatatcaaagctttgaac-aggt
A0A3L7HT14_BCL2A1-      tgagacagaagagatcatcaaggac----------attttcaaacaaggc
A0A3L7HT14_BCL2A1-      tgagacagaagagatcatcaaggac----------attttcaaacaaggc
A0A3L7HT14_BCL2A1-      ---------------cttcatgaag----------aagtttgaac----c
                                       *  *  *             *   *          

Q9JJV8_BCL2-01          ggtggagg--------------aactcttcag------------ggatgg
G3HEA7_BCL2L1-01        agtgaatg--------------aactcttccg------------ggatgg
G3HEA7_BCL2L1-02        agtgaatg--------------aactcttccg------------ggatgg
B2Z3Z4_BCL2L1-01        agtgaatg--------------aactcttccg------------ggatgg
A0A3L7HT14_BCL2A1-      aaaatctgcttcatccctcggtaccggttccagagcaatcacatggacat
A0A3L7HT14_BCL2A1-      aaaatctgcttcatccctcggtaccggttccagagcaatcacatggacat
A0A3L7HT14_BCL2A1-      taaatctg-------gctgggtgacttttc-------------tggaaac
                               *                *  ***              ***   

Q9JJV8_BCL2-01          ggtga-actgggggaggattgtggccttctttgagttcggtg--------
G3HEA7_BCL2L1-01        ggtaa-actggggtcgcattgtggcctttttctccttcggtg--------
G3HEA7_BCL2L1-02        ggtaa-actggggtcgcattgtggcctttttctccttcggtg--------
B2Z3Z4_BCL2L1-01        ggtaa-actggggtcgcattgtggcctttttctccttcggtg--------
A0A3L7HT14_BCL2A1-      ggtgagattagcatcacctgaagagatctctttacttcccaa--aacatc
A0A3L7HT14_BCL2A1-      ggtgagattagcatcacctgaagagatctctttacttcccaa--aacatc
A0A3L7HT14_BCL2A1-      gatagggcag-----atctgggaaatgctcttttctcctcaagcaaca--
                        * *               *           *    * *            

Q9JJV8_BCL2-01          -------------gggtcatgtgtgtggagagcgtcaacagggagatgtc
G3HEA7_BCL2L1-01        -------------gagccctctgtgtggaaagcgtagacaaggagatgca
G3HEA7_BCL2L1-02        -------------gagccctctgtgtggaaagcgtagacaaggagatgca
B2Z3Z4_BCL2L1-01        -------------gagccctctgtgtggaaagcgtagacaaggagatgca
A0A3L7HT14_BCL2A1-      ctggaatattcatcagcccgctgagggagatgc-tcgagaggaggcctta
A0A3L7HT14_BCL2A1-      ctggaatattcatcagcccgctgagggagatgc-tcgagaggaggcctta
A0A3L7HT14_BCL2A1-      -----------------ctactg--------gc-cagagag---------
                                         *   **        **    * *          

Q9JJV8_BCL2-01          acccctggtggacaacatcgc---cctgtggatgaccgagtacctga---
G3HEA7_BCL2L1-01        ggtattggtgagtcggatcgcaagtt---ggatggccacctacctga---
G3HEA7_BCL2L1-02        ggtattggtgagtcggatcgcaagtt---ggatggccacctacctga---
B2Z3Z4_BCL2L1-01        ggtattggtgagtcggatcgcaagtt---ggatggccacctacctga---
A0A3L7HT14_BCL2A1-      tccactggtggacttgacctcatcttcttgccaggccttgggtttgacaa
A0A3L7HT14_BCL2A1-      tccactggtggacttgacctcatcttcttgccaggccttgggtttgacaa
A0A3L7HT14_BCL2A1-      ---------------gaccctggctcc---------------ttcgacaa
                                        * *                          **   

Q9JJV8_BCL2-01          --accggcatctgcacacctggatccaggataacggaggctgggacgcat
G3HEA7_BCL2L1-01        --atgaccacctagagccttggatccaggacaacggcggctgggacactt
G3HEA7_BCL2L1-02        --atgaccacctagagccttggatccaggacaacggcggctgggacactt
B2Z3Z4_BCL2L1-01        --atgaccacctagagccttggatccaggacaacggcggctgggacactt
A0A3L7HT14_BCL2A1-      agatggcaacc----ggctaggg--cggggcaagggctactatgacacct
A0A3L7HT14_BCL2A1-      agatggcaacc----ggctaggg--cggggcaagggctactatgacacct
A0A3L7HT14_BCL2A1-      tggtgaccatc----acttag----------------------------t
                                * *         *                            *

Q9JJV8_BCL2-01          ttgtggaactgtacggccccagtg-----------------tgaggcctc
G3HEA7_BCL2L1-01        tcgtggaactctacggaaacaatgcagcagctgagagccggaaaggcc--
G3HEA7_BCL2L1-02        tcgtggaactctacggaaacaatgcagcagctgagagccggaaaggcc--
B2Z3Z4_BCL2L1-01        tcgtggaactctacggaaacaatgcagcagctgagagccggaaaggcc--
A0A3L7HT14_BCL2A1-      acttgaagcgctgtg-------tgcagcaccaggaagt---gaagcccta
A0A3L7HT14_BCL2A1-      acttgaagcgctgtg-------tgcagcaccaggaagt---gaagcccta
A0A3L7HT14_BCL2A1-      actt------ccatt-------tgcaa----------------------a
                           *                  **                          

Q9JJV8_BCL2-01          tgtttg--------------------atttctcttggctgtctctgaaga
G3HEA7_BCL2L1-01        --------------------aggagcgcttcaaccgctggttcctgacg-
G3HEA7_BCL2L1-02        --------------------aggagcgcttcaaccgctggttcctgacg-
B2Z3Z4_BCL2L1-01        --------------------aggagcgcttcaaccgctggttcctgacg-
A0A3L7HT14_BCL2A1-      caccttggctttggctttcaaagagcagatctgcccccaggtcccagtgg
A0A3L7HT14_BCL2A1-      caccttggctttggctttcaaagagcagatctgcccccaggtcccagtgg
A0A3L7HT14_BCL2A1-      caactcagc-----------------------------------------
                                                                          

Q9JJV8_BCL2-01          ccctgctcagcctggccctggtcggggcctgcatcactctgggtaccta-
G3HEA7_BCL2L1-01        --------ggcatgactgtggctggtg--tggttctgctgggctctc---
G3HEA7_BCL2L1-02        --------ggcatgactgtggctggtg--tggttctgctgggctctc---
B2Z3Z4_BCL2L1-01        --------ggcatgactgtggctggtg--tggttctgctgggctctc---
A0A3L7HT14_BCL2A1-      atgagcatgacatgaaggtagatgaag--tcctttatgaagactgcccag
A0A3L7HT14_BCL2A1-      atgagcatgacatgaaggtagatgaag--tcctttatgaagactgcccag
A0A3L7HT14_BCL2A1-      -------tgacagga-----------------------------------
                                  *  *                                    

Q9JJV8_BCL2-01          ---cctgggccacaagtga
G3HEA7_BCL2L1-01        --tcttcagtcggaagtga
G3HEA7_BCL2L1-02        --tcttcagtcggaagtga
B2Z3Z4_BCL2L1-01        --tcttcagtcggaagtga
A0A3L7HT14_BCL2A1-      catcttaa-----------
A0A3L7HT14_BCL2A1-      catcttaa-----------
A0A3L7HT14_BCL2A1-      ---cttaa-----------
                           * *             

© 1998-2020Legal notice