Dataset for CDS Unclassified of Organism Athene cunicularia

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A663MAW9_uncBAK1-01 Putative BCL2-antagonist/killer 1 gene OS=[Eukaryota] Athene cunicularia (length=450 residues).
atgtcccaaacaaggagaatccccaggcactttgttgtctccagctaccccaatggagcaccagaagaggaaacctacag
taacctccaaacaattccagacaccacagagcaaatggagtttaatatcagctccgccacccaggtcggccaccagctgg
ccctgatcggggacgacttcgacaggatgtaccacaggaagatggaggacacgctgcttcacctggcccgcggagttgcc
atcagtgttttccagacatggaataatattattaaaagcgttctaagaagctttggaactatttggaacaataactggac
aaaaaggatcgttggttatggaagctgggtctggaggctcccctgcagctgcctctgccagaagctggtgcccgcagccc
tgctgctcgttgccttgtggtgggccgtgacttacggactgcggggttaa
© 1998-2023Legal notice