Dataset for CDS BCL-2-like of organism Phasianus colchicus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A669PVQ4_BCL2A1-      atgg-------------aaactgctgagttctattatgtttattatttag
A0A669R428_MCL1-01      atgt-------------------ttgcggtcaagcgga------acgccg
A0A669P0Q7_BCL2L1-      atgtc------------------cagcag-taaccggg------agttag
A0A669PDH6_BCL2-01      atggctcaccccgggagaagaggctacga-caaccgcg------agatag
                        ***                             *           *    *

A0A669PVQ4_BCL2A1-      ctcaagattatctgcaatatgtgcttcag-----gaatcacatcttggac
A0A669R428_MCL1-01      tcatcggcttcaacctcta----ctgcggcggtggaggcccgggagggcc
A0A669P0Q7_BCL2L1-      tgattgactttgtttcctacaagctctcgcagaaggggcactgctggagc
A0A669PDH6_BCL2-01      tgctgaagtacatccactataaactctcgcagcggggctacgactgggcc
                                *        **    **   *     *     *     *  *

A0A669PVQ4_BCL2A1-      cagccca-------------------------------------------
A0A669R428_MCL1-01      cgggcgg-------------------------------------------
A0A669P0Q7_BCL2L1-      gagctggaggaagaggatgagaacag---------------------gac
A0A669PDH6_BCL2-01      --gccgg----------cgaggacaggccacccgtacccccggccctggc
                          *                                               

A0A669PVQ4_BCL2A1-      --------------------------------------------------
A0A669R428_MCL1-01      --------------------------------------------------
A0A669P0Q7_BCL2L1-      tgacactgcagcagaggcagagatggacagcgtcctcaatgggagcccat
A0A669PDH6_BCL2-01      tcccactgctgctcccactgcggtggctgctgc------tggagcctcct
                                                                          

A0A669PVQ4_BCL2A1-      --------------------------------------aaccagagttgc
A0A669R428_MCL1-01      cccggca------------------------------ggacgggcggagc
A0A669P0Q7_BCL2L1-      cctggcacc------cgcctgccggccacg-------tagtgaatggagc
A0A669PDH6_BCL2-01      cccaccaccgccccgagccccccggctcggctgctgctagtga--ggtgc
                                                                     *  **

A0A669PVQ4_BCL2A1-      tcatgtcttgcgaaacattgc-----------------------------
A0A669R428_MCL1-01      cgtcatggagaaag----cgctggaaa-----------------------
A0A669P0Q7_BCL2L1-      caccgtgcacaggagc--agcctggaagttcatgaaattgttcgagcatc
A0A669PDH6_BCL2-01      ccccg-gctgaggggctgcgccccgcacctc------------------c
                                           **                             

A0A669PVQ4_BCL2A1-      -------atcctcactccaagatcagacagagga----------------
A0A669R428_MCL1-01      --------------cgctgcgg-agggtcggggacggagtgatgcagaaa
A0A669P0Q7_BCL2L1-      tgacgtgaggcaggcgctgaga-gatgcaggggatgagtttgagctgagg
A0A669PDH6_BCL2-01      cggcgtccacctcgccctgcgc-caggccggggacgagttctcacgccgc
                                      * *   *        * ***                

A0A669PVQ4_BCL2A1-      --------ggctctcagacccttcttggacaggatcgatattacctccgt
A0A669R428_MCL1-01      cacgaattggccttccagggaatgcttcggaagctggaaatcaaaaaaga
A0A669P0Q7_BCL2L1-      taccggagggctttcagcgacctcacctcccagctccacatcacccctgg
A0A669PDH6_BCL2-01      taccagagggactttgcccagatgtcgggccagctgcacctgacgccctt
                                **   *        *         * *  *  * *       

A0A669PVQ4_BCL2A1-      agatgttgccaagagaattttcaatggagtcatggaagaaaaatttgctg
A0A669R428_MCL1-01      agaag--atctgcaggcagtgtgtg-aggtggctgctaacgttttcagtg
A0A669P0Q7_BCL2L1-      cacag---cgtaccagagctttgagcaggtagtgaacgaactcttccatg
A0A669PDH6_BCL2-01      cacgg---cccacggccgcttcgtggccgtggtggaggagcttttccgtg
                            *              *        **        *    **   **

A0A669PVQ4_BCL2A1-      atggaaatactaactggggacgaattatgaccatatttacttttgg----
A0A669R428_MCL1-01      atggagtaacaaactggggccgagttgtcacactcatctcatttggtgcc
A0A669P0Q7_BCL2L1-      atggcgt---gaactgggggcgcatcgtggctttcttctccttcgg----
A0A669PDH6_BCL2-01      atggggt---caactggggccggatcgtcgccttcttcgagttcgg----
                        ****       ******** **  *  *  *  *  *    ** **    

A0A669PVQ4_BCL2A1-      --aggtcttctcaccaagaagcttcaagagcatgga---------gt---
A0A669R428_MCL1-01      tttgtt-------gcaaaacacctgaaaagcatcaaccaagagaagtgca
A0A669P0Q7_BCL2L1-      --aggg-------gctttgtgcgtggagagcgtggacaaggagatgc---
A0A669PDH6_BCL2-01      --cggt-------gtgatgtgcgtcgagagcgtcaaccgggagatgt---
                           *                 * *  * *** *  *         *    

A0A669PVQ4_BCL2A1-      tcagctcactggagaggagaaggagcagatttcttatttcatcacagagt
A0A669R428_MCL1-01      tcagctcgctggcggggatc--------atcac-----agacgctttggt
A0A669P0Q7_BCL2L1-      ---gggtactggtgggacgc--------attgtgtcttggatgaccacgt
A0A669PDH6_BCL2-01      ---caccgctggtggacaac--------attgccacctggatgaccgagt
                                **** *              **          *       **

A0A669PVQ4_BCL2A1-      acatcataaataacaaagccgcatggata--gatgca----aacggtggc
A0A669R428_MCL1-01      ctcatccaaacg-------cgagtggctgatgagccag------ggaggc
A0A669P0Q7_BCL2L1-      ---atttgaccgaccat-ctagatccctg--gatccaggagaatggcggc
A0A669PDH6_BCL2-01      ---acctgaacaggcac-ctgcataactg--gatccaggacaacggagga
                                *              *   *   **  **       ** ** 

A0A669PVQ4_BCL2A1-      tggga---------------aaacggtttcctaacaaagtttgaaagaag
A0A669R428_MCL1-01      tgggagggctttgtcgactt-------------------cttccgagttg
A0A669P0Q7_BCL2L1-      tggctgctctggataatgctggtcatcttgatcatcccgcccttgtgtag
A0A669PDH6_BCL2-01      tgggatgcctttgtggaattgtacggcaacagtatgaggcctttgttt-g
                        ***                                              *

A0A669PVQ4_BCL2A1-      atcaccactatctttctctacaattacagacatatttgcagctgttttt-
A0A669R428_MCL1-01      a--ggacctggaaagcagcatcaggaacgtgctga---tggcctttgcag
A0A669P0Q7_BCL2L1-      aagggagctgggtccttccctcagcacaaccc--attgtagctgctgtgg
A0A669PDH6_BCL2-01      atttctcctggatc--tctctgaagaccatcctgagcctggttctggtgg
                        *      **             *  *              *         

A0A669PVQ4_BCL2A1-      ---------tccttgttcagagagtactactga-----------------
A0A669R428_MCL1-01      gag------tggctggcctgggggcgagcttggcctacatgatccg----
A0A669P0Q7_BCL2L1-      g-----gcaccacgacccagccaggagggttgg---gaaggagcagcgtg
A0A669PDH6_BCL2-01      gagcttgcatcac--tcttggcgcttatcttgg---acataagtag----
                                           *          **                  

A0A669PVQ4_BCL2A1-      ----------------
A0A669R428_MCL1-01      ------------gtga
A0A669P0Q7_BCL2L1-      ctctgcagcattctga
A0A669PDH6_BCL2-01      ----------------
                                        

© 1998-2020Legal notice