Dataset for CDS BCL-2-like of organism Phasianus colchicus

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A669P0Q7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Phasianus colchicus GN=BCL2L1 (length=705 residues).
atgtccagcagtaaccgggagttagtgattgactttgtttcctacaagctctcgcagaaggggcactgctggagcgagct
ggaggaagaggatgagaacaggactgacactgcagcagaggcagagatggacagcgtcctcaatgggagcccatcctggc
acccgcctgccggccacgtagtgaatggagccaccgtgcacaggagcagcctggaagttcatgaaattgttcgagcatct
gacgtgaggcaggcgctgagagatgcaggggatgagtttgagctgaggtaccggagggctttcagcgacctcacctccca
gctccacatcacccctggcacagcgtaccagagctttgagcaggtagtgaacgaactcttccatgatggcgtgaactggg
ggcgcatcgtggctttcttctccttcggaggggctttgtgcgtggagagcgtggacaaggagatgcgggtactggtggga
cgcattgtgtcttggatgaccacgtatttgaccgaccatctagatccctggatccaggagaatggcggctggctgctctg
gataatgctggtcatcttgatcatcccgcccttgtgtagaagggagctgggtccttccctcagcacaacccattgtagct
gctgtggggcaccacgacccagccaggagggttgggaaggagcagcgtgctctgcagcattctga
>gnl|bcl2dbcds|A0A669PDH6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Phasianus colchicus GN=BCL-2 (length=702 residues).
atggctcaccccgggagaagaggctacgacaaccgcgagatagtgctgaagtacatccactataaactctcgcagcgggg
ctacgactgggccgccggcgaggacaggccacccgtacccccggccctggctcccactgctgctcccactgcggtggctg
ctgctggagcctcctcccaccaccgccccgagccccccggctcggctgctgctagtgaggtgcccccggctgaggggctg
cgccccgcacctcccggcgtccacctcgccctgcgccaggccggggacgagttctcacgccgctaccagagggactttgc
ccagatgtcgggccagctgcacctgacgcccttcacggcccacggccgcttcgtggccgtggtggaggagcttttccgtg
atggggtcaactggggccggatcgtcgccttcttcgagttcggcggtgtgatgtgcgtcgagagcgtcaaccgggagatg
tcaccgctggtggacaacattgccacctggatgaccgagtacctgaacaggcacctgcataactggatccaggacaacgg
aggatgggatgcctttgtggaattgtacggcaacagtatgaggcctttgtttgatttctcctggatctctctgaagacca
tcctgagcctggttctggtgggagcttgcatcactcttggcgcttatcttggacataagtag
>gnl|bcl2dbcds|A0A669PVQ4_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Phasianus colchicus GN=BCL2A1 (length=525 residues).
atggaaactgctgagttctattatgtttattatttagctcaagattatctgcaatatgtgcttcaggaatcacatcttgg
accagcccaaaccagagttgctcatgtcttgcgaaacattgcatcctcactccaagatcagacagaggaggctctcagac
ccttcttggacaggatcgatattacctccgtagatgttgccaagagaattttcaatggagtcatggaagaaaaatttgct
gatggaaatactaactggggacgaattatgaccatatttacttttggaggtcttctcaccaagaagcttcaagagcatgg
agttcagctcactggagaggagaaggagcagatttcttatttcatcacagagtacatcataaataacaaagccgcatgga
tagatgcaaacggtggctgggaaaacggtttcctaacaaagtttgaaagaagatcaccactatctttctctacaattaca
gacatatttgcagctgttttttccttgttcagagagtactactga
>gnl|bcl2dbcds|A0A669R428_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Phasianus colchicus GN=MCL-1 (length=540 residues).
atgtttgcggtcaagcggaacgccgtcatcggcttcaacctctactgcggcggtggaggcccgggagggcccgggcggcc
cggcaggacgggcggagccgtcatggagaaagcgctggaaacgctgcggagggtcggggacggagtgatgcagaaacacg
aattggccttccagggaatgcttcggaagctggaaatcaaaaaagaagaagatctgcaggcagtgtgtgaggtggctgct
aacgttttcagtgatggagtaacaaactggggccgagttgtcacactcatctcatttggtgcctttgttgcaaaacacct
gaaaagcatcaaccaagagaagtgcatcagctcgctggcggggatcatcacagacgctttggtctcatccaaacgcgagt
ggctgatgagccagggaggctgggagggctttgtcgacttcttccgagttgaggacctggaaagcagcatcaggaacgtg
ctgatggcctttgcaggagtggctggcctgggggcgagcttggcctacatgatccggtga
© 1998-2020Legal notice