Dataset for CDS BAK1 of Organism Aquila chrysaetos chrysaetos

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A663F127_BAK1-01      atggcctcagggaacgacggtgacccaccgagggcccacagacgccgggg
A0A663F127_BAK1-02      atggcctcagggaacgacggtgacccaccgagggcccacagacgccgggg
                        **************************************************

A0A663F127_BAK1-01      aagcaacaggcgcaggctgtcacaagagctcaactcagaagaccaggtgg
A0A663F127_BAK1-02      aagcaacaggcgcaggctgtcacaagagctcaactcagaagaccaggtgg
                        **************************************************

A0A663F127_BAK1-01      tggaggagacggaggaggtgtttcggagctatgccttctaccgctaccaa
A0A663F127_BAK1-02      tggaggagacggaggaggtgtttcggagctatgccttctaccgctaccaa
                        **************************************************

A0A663F127_BAK1-01      caggagagagaggagagaggggaggaggtgcccatggacccagagattgt
A0A663F127_BAK1-02      caggagagagaggagagaggggaggaggtgcccatggacccagagattgt
                        **************************************************

A0A663F127_BAK1-01      ggagatccagcaggagctgggcagcaccgggagcctggtaggaaggcgcc
A0A663F127_BAK1-02      ggagatccagcaggagctgggcagcaccgggagcctggtaggaaggcgcc
                        **************************************************

A0A663F127_BAK1-01      tggccatcatcggtgacgacattaataagcggtacgatgcggagtttcgc
A0A663F127_BAK1-02      tggccatcatcggtgacgacattaataagcggtacgatgcggagtttcgc
                        **************************************************

A0A663F127_BAK1-01      tacatgctgaaatccttgcagcccaccaaggagaacgtctatgagcactt
A0A663F127_BAK1-02      tacatgctgaaatccttgcagcccaccaaggagaacgtctatgagcactt
                        **************************************************

A0A663F127_BAK1-01      caccagaatagcctccagcttgttcgagagcggcattaactggggccggg
A0A663F127_BAK1-02      caccagaatagcctccagcttgttcgagagcggcattaactggggccggg
                        **************************************************

A0A663F127_BAK1-01      tgattgcgctgctgggtttcggctaccgcatggccatccacgtctaccag
A0A663F127_BAK1-02      tgattgcgctgctgggtttcggctaccgcatggccatccacgtctaccag
                        **************************************************

A0A663F127_BAK1-01      cacggcacaaggggtttcctctactggatcacccgctacgtctcggagtt
A0A663F127_BAK1-02      cacggcacaaggggtttcctctactggatcacccgctacgtctcggagtt
                        **************************************************

A0A663F127_BAK1-01      catgctccgcaaccgcatcgcccagtggatcgcccagcagggaggatggg
A0A663F127_BAK1-02      catgctccgcaaccgcatcgcccagtggatcgcccagcagggaggatggg
                        **************************************************

A0A663F127_BAK1-01      tg------------------------------------------------
A0A663F127_BAK1-02      tgagccagcgggagcgcggggctgtcccggggggaattcggggacaaggg
                        **                                                

A0A663F127_BAK1-01      ------gctgcactcgagctggacaatgtt----tacatgaagtaca---
A0A663F127_BAK1-02      gaggcagccgtgctccggccggtgaacggtgcagcccggggagtacggca
                              ** *  ***  ** **  ** * *      *  * *****    

A0A663F127_BAK1-01      -tgctggtggtggtgg-----ccctggtcatggtggggcatttagtggta
A0A663F127_BAK1-02      ctgctgcggtcggtggggttacccgggtgccggcagagca---------g
                         *****  *  *****     *** ***   **  * ***          

A0A663F127_BAK1-01      cgacgcttcttcaggc---cctaa
A0A663F127_BAK1-02      caac-ctggcccaggcagatctaa
                        * ** **    *****    ****

© 1998-2023Legal notice