Dataset for CDS BAK1 of Organism Aquila chrysaetos chrysaetos

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A663F127_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Aquila chrysaetos chrysaetos GN=BAK1 (length=654 residues).
atggcctcagggaacgacggtgacccaccgagggcccacagacgccggggaagcaacaggcgcaggctgtcacaagagct
caactcagaagaccaggtggtggaggagacggaggaggtgtttcggagctatgccttctaccgctaccaacaggagagag
aggagagaggggaggaggtgcccatggacccagagattgtggagatccagcaggagctgggcagcaccgggagcctggta
ggaaggcgcctggccatcatcggtgacgacattaataagcggtacgatgcggagtttcgctacatgctgaaatccttgca
gcccaccaaggagaacgtctatgagcacttcaccagaatagcctccagcttgttcgagagcggcattaactggggccggg
tgattgcgctgctgggtttcggctaccgcatggccatccacgtctaccagcacggcacaaggggtttcctctactggatc
acccgctacgtctcggagttcatgctccgcaaccgcatcgcccagtggatcgcccagcagggaggatgggtggctgcact
cgagctggacaatgtttacatgaagtacatgctggtggtggtggccctggtcatggtggggcatttagtggtacgacgct
tcttcaggccctaa
>gnl|bcl2dbcds|A0A663F127_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Aquila chrysaetos chrysaetos GN=BAK1 (length=714 residues).
atggcctcagggaacgacggtgacccaccgagggcccacagacgccggggaagcaacaggcgcaggctgtcacaagagct
caactcagaagaccaggtggtggaggagacggaggaggtgtttcggagctatgccttctaccgctaccaacaggagagag
aggagagaggggaggaggtgcccatggacccagagattgtggagatccagcaggagctgggcagcaccgggagcctggta
ggaaggcgcctggccatcatcggtgacgacattaataagcggtacgatgcggagtttcgctacatgctgaaatccttgca
gcccaccaaggagaacgtctatgagcacttcaccagaatagcctccagcttgttcgagagcggcattaactggggccggg
tgattgcgctgctgggtttcggctaccgcatggccatccacgtctaccagcacggcacaaggggtttcctctactggatc
acccgctacgtctcggagttcatgctccgcaaccgcatcgcccagtggatcgcccagcagggaggatgggtgagccagcg
ggagcgcggggctgtcccggggggaattcggggacaaggggaggcagccgtgctccggccggtgaacggtgcagcccggg
gagtacggcactgctgcggtcggtggggttacccgggtgccggcagagcagcaacctggcccaggcagatctaa
© 1998-2023Legal notice