Dataset for CDS BAK1 of Organism Callithrix jacchus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F7ICC2_BAK1-02      atgg-gtctgtgccactcctgggagct---ggggaggcctg-gggggtcttgcccttctc
F7ICC2_BAK1-04      atggcatcggggcaaggcccaggtcctcccaggcaggagtgcggagagcctgacccaccc
F7ICC2_BAK1-01      atggcatcggggcaaggcccaggtcctcccaggcaggagtgcggagagcctgacccaccc
F7ICC2_BAK1-03      atggcatcggggcaaggcccaggtcctcccaggcaggagtgcggagagcctgacccaccc
                    ****  ** * ** *  **  **  **    ** ***  ** ** *  * ** **  * *

F7ICC2_BAK1-02      tcatggctgctcctctttcatgttgggctcctacccccatccaggaccttgtatcctttt
F7ICC2_BAK1-04      t-----ctgcttct---------------------------gaggagcaggtag------
F7ICC2_BAK1-01      t-----ctgcttct---------------------------gaggagcaggtag------
F7ICC2_BAK1-03      t-----ctgcttct---------------------------gaggagcaggtag------
                    *     ***** **                            **** *  ***       

F7ICC2_BAK1-02      tatttagcccatgcctgccccttgtcccagag------cccagcattcatgttttagaac
F7ICC2_BAK1-04      ------------------cccgggacacagaggaggttttccacagctacgttttttacc
F7ICC2_BAK1-01      ------------------cccgggacacagaggaggttttccacagctacgttttttacc
F7ICC2_BAK1-03      ------------------cccgggacacagaggaggttttccacagctacgttttttacc
                                      ***  * * *****        *  **   * *****  * *

F7ICC2_BAK1-02      attgtcggggatctccaaggaggggtgcacagggccatggacagcttgggcagaaaccct
F7ICC2_BAK1-04      gccatcgg---------------------caggaacagg--------aggctgaag----
F7ICC2_BAK1-01      gccatcgg---------------------caggaacagg--------aggctgaag----
F7ICC2_BAK1-03      gccatcgg---------------------caggaacagg--------aggctgaag----
                        ****                     ****  ** *         *** ***     

F7ICC2_BAK1-02      ctgccatgatgcaggccctggcccccactgcctggccacctgctcacctgcctgcctccc
F7ICC2_BAK1-04      ------------gggcggctgcccctgctgacccagagatggttagcttgtct--ctcca
F7ICC2_BAK1-01      ------------gggcggctgcccctgctgacccagagatggttagcttgtct--ctcca
F7ICC2_BAK1-03      ------------gggcggctgcccctgctgacccagagatggttagcttgtct--ctcca
                                 ***    *****  *** *         * *  * ** **  **** 

F7ICC2_BAK1-02      gctcacacagcaccatggggcaggtgggacggcagctcgctatcattggggatgacatca
F7ICC2_BAK1-04      accta-gcagcaccatggggcaggtgggacggcagctcgctatcattggggatgacatca
F7ICC2_BAK1-01      accta-gcagcaccatggggcaggtgggacggcagctcgctatcattggggatgacatca
F7ICC2_BAK1-03      accta-gcagcaccatggggcaggtgggacggcagctcgctatcattggggatgacatca
                     *  *  *****************************************************

F7ICC2_BAK1-02      accggcgctatgactcggagttccagaccatgctgcagcacctgcagcccacggcagaga
F7ICC2_BAK1-04      accggcgctatgactcggagttccagaccatgctgcagcacctgcagcccacggcagaga
F7ICC2_BAK1-01      accggcgctatgactcggagttccagaccatgctgcagcacctgcagcccacggcagaga
F7ICC2_BAK1-03      accggcgctatgactcggagttccagaccatgctgcagcacctgcagcccacggcagaga
                    ************************************************************

F7ICC2_BAK1-02      acgcctacgagtacttcaccaagatcgcctc-----------------cagcctgtttga
F7ICC2_BAK1-04      acgcctacgagtacttcaccaagatcgcctccaggt-----accccgaccacctccccg-
F7ICC2_BAK1-01      acgcctacgagtacttcaccaagatcgcctc-----------------cagcctgtttga
F7ICC2_BAK1-03      acgcctacgagtacttcaccaagatcgcctccaggccagcaacacccacagcctgtttga
                    *******************************                 *  ***    * 

F7ICC2_BAK1-02      gagtggcatcaactggggccgtgtggtggctctcctgggctttggctacc--------gt
F7ICC2_BAK1-04      ------------ccggactc---tggtcactctcctgtcccgtgacaacctcaccatggc
F7ICC2_BAK1-01      gagtggcatcaactggggccgtgtggtggctctcctgggctttggctacc--------gt
F7ICC2_BAK1-03      gagtggcatcaactggggccgtgtggtggctctcctgggctttggctacc--------gt
                                * **   *   ****  ********  *  ** * ***        * 

F7ICC2_BAK1-02      ctggccctacacgtctaccagcgcggcctgactggcttcctgggccaggtgacccgcttc
F7ICC2_BAK1-04      ctg--cctatatg-atgcactcctggcctgggagacaccttctgtc-ggtgtccagtgtc
F7ICC2_BAK1-01      ctggccctacacgtctaccagcgcggcctgactggcttcctgggccaggtgacccgcttc
F7ICC2_BAK1-03      ctggccctacacgtctaccagcgcggcctga-----------------------------
                    ***  **** * *  * *   *  ******                              

F7ICC2_BAK1-02      gtggtggacttcatgctgcatcactgcatcgcccggtggatcgcacagaggggtggctgg
F7ICC2_BAK1-04      tgctgtgaactcacatgtggtctcggcctcctatttt-----------------------
F7ICC2_BAK1-01      gtggtggacttcatgctgcatcactgcatcgcccggtggatcgcacagaggggtggctgg
F7ICC2_BAK1-03      ------------------------------------------------------------
                                                                                

F7ICC2_BAK1-02      gtggcagccctggacctgggcaatggacccatcctgaatgtgctggtcgttctgggtgtg
F7ICC2_BAK1-04      --------tctctcttagggtcccagactcattcgtattttgtgcat-------------
F7ICC2_BAK1-01      gtggcagccctggacctgggcaatggacccatcctgaatgtgctggtcgttctgggtgtg
F7ICC2_BAK1-03      ------------------------------------------------------------
                                                                                

F7ICC2_BAK1-02      gttctgttgggccagtttgtggtacgaagattcttcaaatcatga
F7ICC2_BAK1-04      -------------------tagctcacagctcttttcagcactga
F7ICC2_BAK1-01      gttctgttgggccagtttgtggtacgaagattcttcaaatcatga
F7ICC2_BAK1-03      ---------------------------------------------
                                                                 

© 1998-2020Legal notice