Dataset for CDS BCL-2-like of organism Pundamilia nyererei

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3B4ETX9_BCL2L10      atg-------------------------tgcagaga--------------
A0A3B4FNX1_BCL2L1-      atgtctcaaaacagagaacttgtgcttttctacataagg--------tat
A0A3B4G3K4_BCL2-01      atg--gcgaacgagtataatcgcaatattgtggaaaagtatatctgccat
A0A3B4G4Z6_MCL1-01      atg--gccaacta-tatga---------tgttgaaaagg-----------
                        ***                         *    * *              

A0A3B4ETX9_BCL2L10      ------------------------------------gcagtctgatatcg
A0A3B4FNX1_BCL2L1-      aaactctcccagagaaactatcctctcaaccacatagtactcaacgagcc
A0A3B4G3K4_BCL2-01      aaactctccaagcggggg----------ttcgtgtggggatttcgcgttg
A0A3B4G4Z6_MCL1-01      ---------aaccagtgc----------accttaatggaatatcttattc
                                                            *   *         

A0A3B4ETX9_BCL2L10      ctgggaggaaaatg----------aaattctgtgggctgtggaaagagac
A0A3B4FNX1_BCL2L1-      ttcgaacaggactgatggggggg-cagcggggttggatgaggaacagcga
A0A3B4G3K4_BCL2-01      tccaagaagaag--------------atgctgctaataacggatcgataa
A0A3B4G4Z6_MCL1-01      ctcaaaatggagtcttggagggaccaatgc-----actacggatcgggaa
                                  *                             ***       

A0A3B4ETX9_BCL2L10      cctggttttggccgagg----actacctgtccttttgctg--------ca
A0A3B4FNX1_BCL2L1-      atagacacacac---------gccaatgggacttttaatggcaccagtcc
A0A3B4G3K4_BCL2-01      ctgaccctccaccgactttggtccaccggtgcc----gagaagccagcac
A0A3B4G4Z6_MCL1-01      attcctctccgcagaac----gccacaggctcctctaaagactctagcaa
                                   *          * *   *  *       *          

A0A3B4ETX9_BCL2L10      cgagtccacatcaagcccctccacc-tcccagcga-atcagc--------
A0A3B4FNX1_BCL2L1-      cgggac----cccaccggcatccccgcagcggcggcagcagc--------
A0A3B4G3K4_BCL2-01      cggg-------------------cc-tgacggcgagagcaacacc-----
A0A3B4G4Z6_MCL1-01      cgggattgtgtccaatggtaccccc-aaacggccgga-caacctcgaggt
                        ** *                   **    * **   * ** *        

A0A3B4ETX9_BCL2L10      cgctgccatga---------------------------------------
A0A3B4FNX1_BCL2L1-      agccgccatcaacg------------------------------------
A0A3B4G3K4_BCL2-01      cacctctgcagacg--------------gctccc----------------
A0A3B4G4Z6_MCL1-01      aacctcaacaaacgggtataaaacaaaagctatccgggaccgggaggaag
                          *  *                                            

A0A3B4ETX9_BCL2L10      -----------------------ggcgtctagg-------ctgggacatc
A0A3B4FNX1_BCL2L1-      acggacctcgacgcagtgaaggaggcgctccgg-----gacacggccaat
A0A3B4G3K4_BCL2-01      acag--tccgaccc----------acacgcagg-----catccaca----
A0A3B4G4Z6_MCL1-01      acgg--ttcgttgccg-------agcaccccggagtttcattcggacagt
                                                 *     **                 

A0A3B4ETX9_BCL2L10      gaaagacagcaccaagctcg------------------------------
A0A3B4FNX1_BCL2L1-      g-agttcg------agctg----------cgatacgctc-----------
A0A3B4G3K4_BCL2-01      g-agtcctgcgcgaggctggagatgaacttgaaa----------------
A0A3B4G4Z6_MCL1-01      g-aatccgacgagcagctggagagagaaacgaaactccttattcacagtt
                        * *   *        ***                                

A0A3B4ETX9_BCL2L10      ----------cttcgacaacctcgctcagaccttcc--------------
A0A3B4FNX1_BCL2L1-      ------gtgccttca----------gcgaccttcacagc-----------
A0A3B4G3K4_BCL2-01      --------gactgtaccag------ccggacttcacggagat--------
A0A3B4G4Z6_MCL1-01      ttttgggtgactttactggactttctcagcctcaacgaaaagaaaccaaa
                                  **              *   *    *              

A0A3B4ETX9_BCL2L10      -----------------------tggtgcagtgtggaccagaccactgcc
A0A3B4FNX1_BCL2L1-      ----------------------------cagc-tgcacatcacgccggcc
A0A3B4G3K4_BCL2-01      ---------------------gtcgcggcagc-tgcatctcacctccgcc
A0A3B4G4Z6_MCL1-01      gcactaaagacgatgaaaagagttgttgcgga-cgtattaga--------
                                                    * *   * *    *        

A0A3B4ETX9_BCL2L10      tcagcct-----------cagaaaggtgatgaaggagctggttggggatg
A0A3B4FNX1_BCL2L1-      acggcctaccaaagctt-cgagaacgtgatggacgaggtgttccgggacg
A0A3B4G3K4_BCL2-01      acggcgcagaggaggtt-cgccgaggtgatagacgaactgttccgggacg
A0A3B4G4Z6_MCL1-01      aaagcacagatacgcttacaacggaatgattaataaattgtcattggatg
                           **             *       ****  *  *  **     *** *

A0A3B4ETX9_BCL2L10      gacacttgaactgggggagg------gttgtttctcttttcgcc------
A0A3B4FNX1_BCL2L1-      gc---gttaactggggccgc------atcgtagggcttttcgcg------
A0A3B4G3K4_BCL2-01      gg---gtgaactggggccgg------attattgctttcttcgag------
A0A3B4G4Z6_MCL1-01      aa---agagacgaggatatgtcatttgtcggtgctgtagcgaagagcctc
                                 **  **            *        *             

A0A3B4ETX9_BCL2L10      tttactggagt----------gctggccagaaagatcctggag-------
A0A3B4FNX1_BCL2L1-      ttcggcggggc----------actgt-------gt--gtcgagtgcg---
A0A3B4G3K4_BCL2-01      tttg--ggggc----------actgt-------gtgcgtggagtgcgctt
A0A3B4G4Z6_MCL1-01      tttg--gagaccacacgaccaactgg-------ggtcgtattgtcagctt
                        **    *               ***        *    *   *       

A0A3B4ETX9_BCL2L10      -----cagaagccggggctggaccctgg----tcaacagcaggaactggg
A0A3B4FNX1_BCL2L1-      -----tcgagaaggagatgagccccttg------------------gtgg
A0A3B4G3K4_BCL2-01      -----ccaacgaggggatgtcatcccag------------------gtgg
A0A3B4G4Z6_MCL1-01      tatggccttcggggcagtggtctctcagcacctgaaggaaaagggcaggg
                                     *         *   *                    **

A0A3B4ETX9_BCL2L10      acaggagcccatgagctgcagaaggctggcagagaccatag--ctgatta
A0A3B4FNX1_BCL2L1-      gcaggatc--------------------gtagagtggatga--cggtcta
A0A3B4G3K4_BCL2-01      acaacatc--------------------gcagactggatga--cggagta
A0A3B4G4Z6_MCL1-01      acaactac--------------------gtggcgctagtgagccaagaga
                         **    *                    *  *      *    *     *

A0A3B4ETX9_BCL2L10      cctgggagaa----------gagaagaaagactggctgttggataatgat
A0A3B4FNX1_BCL2L1-      cctagacaaccacatt-------cagcc---ctggatccagagccaagga
A0A3B4G3K4_BCL2-01      tttaaatggacc-----tcttaacag-----ctggatacaagataacggg
A0A3B4G4Z6_MCL1-01      tttctgcatacctgctgtctgaacagcgagactggattgtaaaaaacaat
                          *                     **     **** *        *    

A0A3B4ETX9_BCL2L10      ggatgggaaggcttctgtaagttctcccgcagtgccagagaagtgagcca
A0A3B4FNX1_BCL2L1-      ggatgggagcgcttcgctgaaatctt----cgggcaggatgcggcggctg
A0A3B4G3K4_BCL2-01      ggatgggatgcatttgtggagct-gtacgacagacagagggactccgtct
A0A3B4G4Z6_MCL1-01      gcatgggatggctttgtggagttctttcgagtagcaga---------ccc
                        * ******    **     *  *           *               

A0A3B4ETX9_BCL2L10      ggactca------------tccatgaagaaagcgct----gtttgctgcc
A0A3B4FNX1_BCL2L1-      aaagccggaggtc----------tcaggagagtttcaagaagtggctgct
A0A3B4G3K4_BCL2-01      tcagttgct--cctggccctccatcaagacagtttt-cggcttggctgcg
A0A3B4G4Z6_MCL1-01      tgagtcgatagtcaggcacacgctcatggcctttgc-tggatttgctggt
                          *                    * * *              * ****  

A0A3B4ETX9_BCL2L10      gccgg---tgtcggccttgctgggcttacc-----ttcctcttggtgcgc
A0A3B4FNX1_BCL2L1-      ggtggggatgacggtggtgacaggcgttgtggcgggtgcgcttatcgcgc
A0A3B4G3K4_BCL2-01      ctcgg-------agcg--gccagcctcacc-atcggagcataccttacac
A0A3B4G4Z6_MCL1-01      attgg-------ggcaacactggccctgttgatcagttgctgggatgcat
                           **        *        * *                      *  

A0A3B4ETX9_BCL2L10      tag-----------
A0A3B4FNX1_BCL2L1-      aaaaacgcctgtga
A0A3B4G3K4_BCL2-01      aaa------agtga
A0A3B4G4Z6_MCL1-01      tat------tgtga

© 1998-2020Legal notice