Dataset for CDS BCL2L10 of organism Papio anubis

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A096NM44_BCL2L10      ---------------------------atggctgacccgttgcgggagcg
A0A8I5NQD2_BCL2L10      actgtagagtccttgagaggccggaccatggctgacccgttgcgggagcg
                                                   ***********************

A0A096NM44_BCL2L10      caccgagcggctcctggccgactatctggggtgctgcgcccgggaacccg
A0A8I5NQD2_BCL2L10      caccgagcggctcctggccgactatctggggtgctgcgcccgggaacccg
                        **************************************************

A0A096NM44_BCL2L10      gcacccctgagccgaggccgtccacgcccgaggccgccgtgctgcgctca
A0A8I5NQD2_BCL2L10      gcacccctgagccgaggccgtccacgcccgaggccgccgtgctgcgctca
                        **************************************************

A0A096NM44_BCL2L10      gcagccgccaggttacggcagctccaccggtccttcttctccgcctaccg
A0A8I5NQD2_BCL2L10      gcagccgccaggttacggcagctccaccggtccttcttctccgcctaccg
                        **************************************************

A0A096NM44_BCL2L10      cggctaccccgggaaccgcgtcgagctggtggcgctgatggcggaggccg
A0A8I5NQD2_BCL2L10      cggctaccccgggaaccgcgtcgagctggtggcgctgatggcggaggccg
                        **************************************************

A0A096NM44_BCL2L10      tgctctccgacagccccggccccacctggggcagggtggtgtcgctggtg
A0A8I5NQD2_BCL2L10      tgctctccgacagccccggccccacctggggcagggtggtgtcgctggtg
                        **************************************************

A0A096NM44_BCL2L10      accttcgcggggacgctgctggagagagagccgctggtgacagcctggtg
A0A8I5NQD2_BCL2L10      accttcgcggggacgctgctggagagagagccgctggtgacagcctggtg
                        **************************************************

A0A096NM44_BCL2L10      gaagaagcggagcttccagccgcggctgaaggagcaggagggcgacgtcg
A0A8I5NQD2_BCL2L10      gaagaagcggagcttccagccgcggctgaaggagcaggagggcgacgtcg
                        **************************************************

A0A096NM44_BCL2L10      cccgggactgccagcgcctggtggccttgctgagctcgcggctcgcgggg
A0A8I5NQD2_BCL2L10      cccgggactgccagcgcctggtggccttgctgagctcgcggctcgcgggg
                        **************************************************

A0A096NM44_BCL2L10      cagcaccgcgcctggcttcaggctcagggcggctgggatggcttttgtca
A0A8I5NQD2_BCL2L10      cagcaccgcgcctggcttcaggctcagggcggctgggatggcttttgtca
                        **************************************************

A0A096NM44_BCL2L10      cttcttcaggagcccctttccgctggctttttggagaaaactgctgatcc
A0A8I5NQD2_BCL2L10      cttcttcaggagcccctttccgctggctttttggagaaaactgctgatcc
                        **************************************************

A0A096NM44_BCL2L10      aggctttcctggcatgcttgttagcaacagccttcggttatctctggaca
A0A8I5NQD2_BCL2L10      aggctttcctggcatgcttgttagcaacagccttcggttatctctggaca
                        **************************************************

A0A096NM44_BCL2L10      cgattattatga
A0A8I5NQD2_BCL2L10      cgattattatga
                        ************

© 1998-2023Legal notice