Dataset for CDS BCL2L10 of organism Papio anubis

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A096NM44_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Papio anubis GN=BCL2L10 (length=585 residues).
atggctgacccgttgcgggagcgcaccgagcggctcctggccgactatctggggtgctgcgcccgggaacccggcacccc
tgagccgaggccgtccacgcccgaggccgccgtgctgcgctcagcagccgccaggttacggcagctccaccggtccttct
tctccgcctaccgcggctaccccgggaaccgcgtcgagctggtggcgctgatggcggaggccgtgctctccgacagcccc
ggccccacctggggcagggtggtgtcgctggtgaccttcgcggggacgctgctggagagagagccgctggtgacagcctg
gtggaagaagcggagcttccagccgcggctgaaggagcaggagggcgacgtcgcccgggactgccagcgcctggtggcct
tgctgagctcgcggctcgcggggcagcaccgcgcctggcttcaggctcagggcggctgggatggcttttgtcacttcttc
aggagcccctttccgctggctttttggagaaaactgctgatccaggctttcctggcatgcttgttagcaacagccttcgg
ttatctctggacacgattattatga
>gnl|bcl2dbcds|A0A8I5NQD2_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Papio anubis GN=BCL2L10 (length=612 residues).
actgtagagtccttgagaggccggaccatggctgacccgttgcgggagcgcaccgagcggctcctggccgactatctggg
gtgctgcgcccgggaacccggcacccctgagccgaggccgtccacgcccgaggccgccgtgctgcgctcagcagccgcca
ggttacggcagctccaccggtccttcttctccgcctaccgcggctaccccgggaaccgcgtcgagctggtggcgctgatg
gcggaggccgtgctctccgacagccccggccccacctggggcagggtggtgtcgctggtgaccttcgcggggacgctgct
ggagagagagccgctggtgacagcctggtggaagaagcggagcttccagccgcggctgaaggagcaggagggcgacgtcg
cccgggactgccagcgcctggtggccttgctgagctcgcggctcgcggggcagcaccgcgcctggcttcaggctcagggc
ggctgggatggcttttgtcacttcttcaggagcccctttccgctggctttttggagaaaactgctgatccaggctttcct
ggcatgcttgttagcaacagccttcggttatctctggacacgattattatga
© 1998-2023Legal notice