Dataset for CDS BCL2L1 of organism Sparus aurata

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A0B4KJI5_BCL2L1-      atgtcgtacagtaacagagagctagtggagtcctttttaagctacaaact
A0A671WXV0_BCL2L1-      atgtcacaa---aacagagaactggtggttttctacataaactataaact
                        *****  *    ******** ** ****  * **   *** *** *****

A0A0B4KJI5_BCL2L1-      gtctcagaggaactatccaactgccctgctgagg------------ccag
A0A671WXV0_BCL2L1-      ctcccagagaaactatcctctcaaccacatgggactcatagagtctccaa
                         ** ***** ********      **   ** *             *** 

A0A0B4KJI5_BCL2L1-      atgatgctggtggaaggactgaggcagacaaagccaactcagctgccaca
A0A671WXV0_BCL2L1-      acaggactgatgggggggc-gacgcacgccaatgggactt--------tt
                        *     *** ***  ** * ** ***  * **    ***           

A0A0B4KJI5_BCL2L1-      aatggcctg----ctgg-------ccaaca-----------gcagcaacg
A0A671WXV0_BCL2L1-      aacggcatgagtcctggcacacccccagcatcccctcttcggcagcaacg
                        ** *** **    ****       *** **           *********

A0A0B4KJI5_BCL2L1-      ggggcggacagccaggtgctgacatagaggctgttaaagcagctcttcgg
A0A671WXV0_BCL2L1-      gttgccgtcaacaa----caagcctggacgcagtgaaagaagccctacgg
                        *  ** * ** * *    *   * * ** ** ** **** *** ** ***

A0A0B4KJI5_BCL2L1-      gactcatctgaagagtttgaactgctcttcacacaagcgtttagtgacct
A0A671WXV0_BCL2L1-      gactctgccaatgagttcgagctgcgatatgcgcgcgccttcagcgacct
                        *****  *  * ***** ** ****  *   * *  ** ** ** *****

A0A0B4KJI5_BCL2L1-      ctccacgcagctcgacatcactcctgacacagcctaccacagctttaaga
A0A671WXV0_BCL2L1-      gcacaaccagctgcacatcacaccggccacagcctaccaaagcttcgaaa
                           **  *****  ******* ** * ************ *****  * *

A0A0B4KJI5_BCL2L1-      gcgtgatggacgaggtgttcaaggacggagtcaactggggacgtgtagtg
A0A671WXV0_BCL2L1-      acgtgatggacgaggtgttccgggacggagtcaactggggtcgtgtagta
                         *******************  ****************** ******** 

A0A0B4KJI5_BCL2L1-      ggcctgtttgcttttggcggtgtgctgtgtgtggaatgcgttgagaagga
A0A671WXV0_BCL2L1-      gggctttttgctttcggtggagcgctgtgcgtggagtgcatggagaagga
                        ** ** ******** ** ** * ****** ***** *** * ********

A0A0B4KJI5_BCL2L1-      tacgagcgagctggtctcccgcatcgcagactggatgaccatgtacctgg
A0A671WXV0_BCL2L1-      gatgagtccgctggtcggcaggatcatagagtggatgacggtctacctgg
                         * ***   *******  * * ***  *** ********  * *******

A0A0B4KJI5_BCL2L1-      atgagcacatcaatccgtggattgagagccaaggaggatgggactccttt
A0A671WXV0_BCL2L1-      acaaccacattcagccctggatccagagccaaggaggatgggagcgcttt
                        *  * *****  * ** *****  *******************   ****

A0A0B4KJI5_BCL2L1-      gctgaggtttttgggcgagacgcagctgcagaagcgaggagatctcggga
A0A671WXV0_BCL2L1-      gctgaaatcttcgggcaggacgcggcggcagagagcaggaggtctcagga
                        *****  * ** ****  ***** ** *****    ***** **** ***

A0A0B4KJI5_BCL2L1-      gactctgagtcggtggctgctggttggagtggcgctgctaatgggagttg
A0A671WXV0_BCL2L1-      gagtttcaagaagtggctgctggcggggatgaccctggtgaccggggtcg
                        ** * * *    ***********  **  ** * *** * *  ** ** *

A0A0B4KJI5_BCL2L1-      tgctcggtgtcctcatcgctaagaaaca---gtga
A0A671WXV0_BCL2L1-      tggtgggctcactcatcgcccagaaacgcctgtga
                        ** * **    ********  ******    ****

© 1998-2020Legal notice