Dataset for CDS BCL2L2 of organism Homo sapiens

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|Q92843_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Homo sapiens GN=BCL2L2 (length=447 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaacgcttcacc
caggtctccgatgaactttttcaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcagc
tggctgactggatccacagcagtgggggctgggcggagttcacagct
>gnl|bcl2dbcds|Q92843_BCL2L2-04 BCL2-like 2 gene OS=[Eukaryota] Homo sapiens GN=BCL2L2 (length=432 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaacgcttcacc
caggtctccgatgaactttttcaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcagc
tggctgactggatccacagcagtgggggctgg
>gnl|bcl2dbcds|Q92843_BCL2L2-05 BCL2-like 2 gene OS=[Eukaryota] Homo sapiens GN=BCL2L2 (length=215 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgacccc
>gnl|bcl2dbcds|Q92843_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Homo sapiens GN=BCL2L2 (length=155 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatga
>gnl|bcl2dbcds|Q92843_BCL2L2-06 BCL2-like 2 gene OS=[Eukaryota] Homo sapiens GN=BCL2L2 (length=502 residues).
gcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtctccgatg
aactttttcaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtgtgctgagagtgtc
aacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcagctggctgactggat
ccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcggcgtctgcgggagg
ggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtatggagcacactcttcacccta
ccctctaccacaggacacatatccctgttagcattccccgggacctttagccaagaggagctgcagggaccatggccagg
ttaccaaaatgccctgctctga
>gnl|bcl2dbcds|Q92843_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Homo sapiens GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaacgcttcacc
caggtctccgatgaactttttcaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcagc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
© 1998-2020Legal notice