Dataset for CDS BCL2L2 of organism Homo sapiens

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q92843_BCL2L2-10      --------------------------------------------------
Q92843_BCL2L2-07      atggcgaccccagcctcggccccagacacacgggctctggtggcagactt
Q92843_BCL2L2-04      atggcgaccccagcctcggccccagacacacgggctctggtggcagactt
Q92843_BCL2L2-01      atggcgaccccagcctcggccccagacacacgggctctggtggcagactt
Q92843_BCL2L2-02      atggcgaccccagcctcggccccagacacacgggctctggtggcagactt
Q92843_BCL2L2-03      atggcgaccccagcctcggccccagacacacgggctctggtggcagactt
Q92843_BCL2L2-05      atggcgaccccagcctcggccccagacacacgggctctggtggcagactt
Q92843_BCL2L2-06      atggcgaccccagcctcggccccagacacacgggctctggtggcagactt
Q92843_BCL2L2-08      atggcgaccccagcctcggccccagacacacgggctctggtggcagactt
Q92843_BCL2L2-09      atggcgaccccagcctcggccccagacacacgggctctggtggcagactt
                                                                        

Q92843_BCL2L2-10      --------------------------------------------------
Q92843_BCL2L2-07      tgtaggttataagctgaggcagaagggttatgtctgtggagctggccccg
Q92843_BCL2L2-04      tgtaggttataagctgaggcagaagggttatgtctgtggagctggccccg
Q92843_BCL2L2-01      tgtaggttataagctgaggcagaagggttatgtctgtggagctggccccg
Q92843_BCL2L2-02      tgtaggttataagctgaggcagaagggttatgtctgtggagctggccccg
Q92843_BCL2L2-03      tgtaggttataagctgaggcagaagggttatgtctgtggagctggccccg
Q92843_BCL2L2-05      tgtaggttataagctgaggcagaagggttatgtctgtggagctggccccg
Q92843_BCL2L2-06      tgtaggttataagctgaggcagaagggttatgtctgtggagctggccccg
Q92843_BCL2L2-08      tgtaggttataagctgaggcagaagggttatgtctgtggagctggccccg
Q92843_BCL2L2-09      tgtaggttataagctgaggcagaagggttatgtctgtggagctggccccg
                                                                        

Q92843_BCL2L2-10      --------------------------------------------------
Q92843_BCL2L2-07      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga
Q92843_BCL2L2-04      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga
Q92843_BCL2L2-01      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga
Q92843_BCL2L2-02      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga
Q92843_BCL2L2-03      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga
Q92843_BCL2L2-05      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga
Q92843_BCL2L2-06      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga
Q92843_BCL2L2-08      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga
Q92843_BCL2L2-09      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga
                                                                        

Q92843_BCL2L2-10      -----------------------gcgcaccttctctgatctggcggctca
Q92843_BCL2L2-07      gatgagttcgagacccgcttccggcgcaccttctctgatctggcggctca
Q92843_BCL2L2-04      gatgagttcgagacccgcttccggcgcaccttctctgatctggcggctca
Q92843_BCL2L2-01      gatga---------------------------------------------
Q92843_BCL2L2-02      gatgagttcgagacccgcttccggcgcaccttctctgatctggcggctca
Q92843_BCL2L2-03      gatgagttcgagacccgcttccggcgcaccttctctgatctggcggctca
Q92843_BCL2L2-05      gatgagttcgagacccgcttccggcgcaccttctctgatctggcggctca
Q92843_BCL2L2-06      gatgagttcgagacccgcttccggcgcaccttctctgatctggcggctca
Q92843_BCL2L2-08      gatgagttcgagacccgcttccggcgcaccttctctgatctggcggctca
Q92843_BCL2L2-09      gatgagttcgagacccgcttccggcgcaccttctctgatctggcggctca
                                                                        

Q92843_BCL2L2-10      gctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtctccg
Q92843_BCL2L2-07      gctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtctccg
Q92843_BCL2L2-04      gctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtctccg
Q92843_BCL2L2-01      --------------------------------------------------
Q92843_BCL2L2-02      gctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtctccg
Q92843_BCL2L2-03      gctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtctccg
Q92843_BCL2L2-05      gctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtctccg
Q92843_BCL2L2-06      gctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtctccg
Q92843_BCL2L2-08      gctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtctccg
Q92843_BCL2L2-09      gctgcatgtgacccc-----------------------------------
                                                                        

Q92843_BCL2L2-10      atgaactttttcaagggggccccaactggggccgccttgtagccttcttt
Q92843_BCL2L2-07      atgaactttttcaagggggccccaactggggccgccttgtagccttcttt
Q92843_BCL2L2-04      atgaactttttcaagggggccccaactggggccgccttgtagccttcttt
Q92843_BCL2L2-01      --------------------------------------------------
Q92843_BCL2L2-02      atgaactttttcaagggggccccaactggggccgccttgtagccttcttt
Q92843_BCL2L2-03      atgaactttttcaagggggccccaactggggccgccttgtagccttcttt
Q92843_BCL2L2-05      atgaactttttcaagggggccccaactggggccgccttgtagccttcttt
Q92843_BCL2L2-06      atgaactttttcaagggggccccaactggggccgccttgtagccttcttt
Q92843_BCL2L2-08      atgaactttttcaagggggccccaactggggccgccttgtagccttcttt
Q92843_BCL2L2-09      --------------------------------------------------
                                                                        

Q92843_BCL2L2-10      gtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggaacc
Q92843_BCL2L2-07      gtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggaacc
Q92843_BCL2L2-04      gtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggaacc
Q92843_BCL2L2-01      --------------------------------------------------
Q92843_BCL2L2-02      gtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggaacc
Q92843_BCL2L2-03      gtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggaacc
Q92843_BCL2L2-05      gtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggaacc
Q92843_BCL2L2-06      gtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggaacc
Q92843_BCL2L2-08      gtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggaacc
Q92843_BCL2L2-09      --------------------------------------------------
                                                                        

Q92843_BCL2L2-10      actggtgggacaagtgcaggagtggatggtggcctacctggagacgcagc
Q92843_BCL2L2-07      actggtgggacaagtgcaggagtggatggtggcctacctggagacgcagc
Q92843_BCL2L2-04      actggtgggacaagtgcaggagtggatggtggcctacctggagacgcagc
Q92843_BCL2L2-01      --------------------------------------------------
Q92843_BCL2L2-02      actggtgggacaagtgcaggagtggatggtggcctacctggagacgcagc
Q92843_BCL2L2-03      actggtgggacaagtgcaggagtggatggtggcctacctggagacgcagc
Q92843_BCL2L2-05      actggtgggacaagtgcaggagtggatggtggcctacctggagacgcagc
Q92843_BCL2L2-06      actggtgggacaagtgcaggagtggatggtggcctacctggagacgcagc
Q92843_BCL2L2-08      actggtgggacaagtgcaggagtggatggtggcctacctggagacgcagc
Q92843_BCL2L2-09      --------------------------------------------------
                                                                        

Q92843_BCL2L2-10      tggctgactggatccacagcagtgggggctgggcggag---ttcaca---
Q92843_BCL2L2-07      tggctgactggatccacagcagtgggggctgggtaagaagcttctcaatt
Q92843_BCL2L2-04      tggctgactggatccacagcagtgggggctgggtatgg---agcacactc
Q92843_BCL2L2-01      --------------------------------------------------
Q92843_BCL2L2-02      tggctgactggatccacagcagtgggggctgggcggag---ttcaca---
Q92843_BCL2L2-03      tggctgactggatccacagcagtgggggctgggcggag---ttcaca---
Q92843_BCL2L2-05      tggctgactggatccacagcagtgggggctgggcggag---ttcaca---
Q92843_BCL2L2-06      tggctgactggatccacagcagtgggggctgggcggag---ttcaca---
Q92843_BCL2L2-08      tggctgactggatccacagcagtgggggctgggcggag---ttcaca---
Q92843_BCL2L2-09      --------------------------------------------------
                                                                        

Q92843_BCL2L2-10      --------gctctatac----ggggacggggccctggaggagg----cgc
Q92843_BCL2L2-07      gcc-----gctctgcac-------------atcct---------------
Q92843_BCL2L2-04      ttcaccctaccctctaccacaggacacatatccctgttagcattccccgg
Q92843_BCL2L2-01      --------------------------------------------------
Q92843_BCL2L2-02      --------gctctatac----ggggacggggccctggaggagg----cgc
Q92843_BCL2L2-03      --------gctctatac----ggggacggggccctggaggagg----cgc
Q92843_BCL2L2-05      --------gctctatac----ggggacggggccctggaggagg----cgc
Q92843_BCL2L2-06      --------gctctatac----ggggacggggccctggaggagg----cgc
Q92843_BCL2L2-08      --------gctctatac----ggggacggggccctggaggagg----cgc
Q92843_BCL2L2-09      --------------------------------------------------
                                                                        

Q92843_BCL2L2-10      ggcgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggg
Q92843_BCL2L2-07      ----tctgc------aaagctggtctccagggggaa-------gatgggg
Q92843_BCL2L2-04      gacctttagccaagaggagctg-----------------------caggg
Q92843_BCL2L2-01      --------------------------------------------------
Q92843_BCL2L2-02      ggcgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggg
Q92843_BCL2L2-03      ggcgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggg
Q92843_BCL2L2-05      ggcgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggg
Q92843_BCL2L2-06      ggcgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggg
Q92843_BCL2L2-08      ggcgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggg
Q92843_BCL2L2-09      --------------------------------------------------
                                                                        

Q92843_BCL2L2-10      gccgtggcactgggggccctggtatggagcacactcttcaccctaccctc
Q92843_BCL2L2-07      gctctga-------------------------------------------
Q92843_BCL2L2-04      accatgg----------ccaggtt--------------------------
Q92843_BCL2L2-01      --------------------------------------------------
Q92843_BCL2L2-02      gccgtggcactgggggccctggta--------------------------
Q92843_BCL2L2-03      gccgtggcactgggggccctggta--------------------------
Q92843_BCL2L2-05      gccgtggcactgggggccctggta--------------------------
Q92843_BCL2L2-06      gccgtggcactgggggccctggta--------------------------
Q92843_BCL2L2-08      gccgtggcactgggggccctggta--------------------------
Q92843_BCL2L2-09      --------------------------------------------------
                                                                        

Q92843_BCL2L2-10      taccacaggacacatatccctgttagcattccccgggacctttagccaag
Q92843_BCL2L2-07      --------------------------------------------------
Q92843_BCL2L2-04      --------------------------------------------------
Q92843_BCL2L2-01      --------------------------------------------------
Q92843_BCL2L2-02      --------------------------------------------------
Q92843_BCL2L2-03      --------------------------------------------------
Q92843_BCL2L2-05      --------------------------------------------------
Q92843_BCL2L2-06      --------------------------------------------------
Q92843_BCL2L2-08      --------------------------------------------------
Q92843_BCL2L2-09      --------------------------------------------------
                                                                        

Q92843_BCL2L2-10      aggagctgcagggaccatggccaggttaccaaaatgccctgctctga---
Q92843_BCL2L2-07      --------------------------------------------------
Q92843_BCL2L2-04      ---------------------------accaaaatgccctgctctga---
Q92843_BCL2L2-01      --------------------------------------------------
Q92843_BCL2L2-02      ---------------------------actgtaggggccttttttgctag
Q92843_BCL2L2-03      ---------------------------actgtaggggccttttttgctag
Q92843_BCL2L2-05      ---------------------------actgtaggggccttttttgctag
Q92843_BCL2L2-06      ---------------------------actgtaggggccttttttgctag
Q92843_BCL2L2-08      ---------------------------actgtaggggccttttttgctag
Q92843_BCL2L2-09      --------------------------------------------------
                                                                        

Q92843_BCL2L2-10      -------
Q92843_BCL2L2-07      -------
Q92843_BCL2L2-04      -------
Q92843_BCL2L2-01      -------
Q92843_BCL2L2-02      caagtga
Q92843_BCL2L2-03      caagtga
Q92843_BCL2L2-05      caagtga
Q92843_BCL2L2-06      caagtga
Q92843_BCL2L2-08      caagtga
Q92843_BCL2L2-09      -------
                             

© 1998-2021Legal notice