Dataset for CDS BCL2L2 of organism Homo sapiens

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

Q92843_BCL2L2-06      --------------------------------------------------
Q92843_BCL2L2-01      atggcgaccccagcctcggccccagacacacgggctctggtggcagactt
Q92843_BCL2L2-02      atggcgaccccagcctcggccccagacacacgggctctggtggcagactt
Q92843_BCL2L2-03      atggcgaccccagcctcggccccagacacacgggctctggtggcagactt
Q92843_BCL2L2-04      atggcgaccccagcctcggccccagacacacgggctctggtggcagactt
Q92843_BCL2L2-05      atggcgaccccagcctcggccccagacacacgggctctggtggcagactt

Q92843_BCL2L2-06      --------------------------------------------------
Q92843_BCL2L2-01      tgtaggttataagctgaggcagaagggttatgtctgtggagctggccccg
Q92843_BCL2L2-02      tgtaggttataagctgaggcagaagggttatgtctgtggagctggccccg
Q92843_BCL2L2-03      tgtaggttataagctgaggcagaagggttatgtctgtggagctggccccg
Q92843_BCL2L2-04      tgtaggttataagctgaggcagaagggttatgtctgtggagctggccccg
Q92843_BCL2L2-05      tgtaggttataagctgaggcagaagggttatgtctgtggagctggccccg

Q92843_BCL2L2-06      --------------------------------------------------
Q92843_BCL2L2-01      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga
Q92843_BCL2L2-02      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga
Q92843_BCL2L2-03      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga
Q92843_BCL2L2-04      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga
Q92843_BCL2L2-05      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga

Q92843_BCL2L2-06      -----------------------gcgcaccttctctgatctggcggctca
Q92843_BCL2L2-01      gatga---------------------------------------------
Q92843_BCL2L2-02      gatgagttcgagacccgcttccggcgcaccttctctgatctggcggctca
Q92843_BCL2L2-03      gatgagttcgagacccgcttccggcgcaccttctctgatctggcggctca
Q92843_BCL2L2-04      gatgagttcgagacccgcttccggcgcaccttctctgatctggcggctca
Q92843_BCL2L2-05      gatgagttcgagacccgcttccggcgcaccttctctgatctggcggctca

Q92843_BCL2L2-06      gctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtctccg
Q92843_BCL2L2-01      --------------------------------------------------
Q92843_BCL2L2-02      gctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtctccg
Q92843_BCL2L2-03      gctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtctccg
Q92843_BCL2L2-04      gctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtctccg
Q92843_BCL2L2-05      gctgcatgtgacccc-----------------------------------

Q92843_BCL2L2-06      atgaactttttcaagggggccccaactggggccgccttgtagccttcttt
Q92843_BCL2L2-01      --------------------------------------------------
Q92843_BCL2L2-02      atgaactttttcaagggggccccaactggggccgccttgtagccttcttt
Q92843_BCL2L2-03      atgaactttttcaagggggccccaactggggccgccttgtagccttcttt
Q92843_BCL2L2-04      atgaactttttcaagggggccccaactggggccgccttgtagccttcttt
Q92843_BCL2L2-05      --------------------------------------------------

Q92843_BCL2L2-06      gtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggaacc
Q92843_BCL2L2-01      --------------------------------------------------
Q92843_BCL2L2-02      gtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggaacc
Q92843_BCL2L2-03      gtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggaacc
Q92843_BCL2L2-04      gtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggaacc
Q92843_BCL2L2-05      --------------------------------------------------

Q92843_BCL2L2-06      actggtgggacaagtgcaggagtggatggtggcctacctggagacgcagc
Q92843_BCL2L2-01      --------------------------------------------------
Q92843_BCL2L2-02      actggtgggacaagtgcaggagtggatggtggcctacctggagacgcagc
Q92843_BCL2L2-03      actggtgggacaagtgcaggagtggatggtggcctacctggagacgcagc
Q92843_BCL2L2-04      actggtgggacaagtgcaggagtggatggtggcctacctggagacgcagc
Q92843_BCL2L2-05      --------------------------------------------------

Q92843_BCL2L2-06      tggctgactggatccacagcagtgggggctgggcggagttcacagctcta
Q92843_BCL2L2-01      --------------------------------------------------
Q92843_BCL2L2-02      tggctgactggatccacagcagtgggggctgggcggagttcacagctcta
Q92843_BCL2L2-03      tggctgactggatccacagcagtgggggctgggcggagttcacagct---
Q92843_BCL2L2-04      tggctgactggatccacagcagtgggggctgg------------------
Q92843_BCL2L2-05      --------------------------------------------------

Q92843_BCL2L2-06      tacggggacggggccctggaggaggcgcggcgtctgcgggaggggaactg
Q92843_BCL2L2-01      --------------------------------------------------
Q92843_BCL2L2-02      tacggggacggggccctggaggaggcgcggcgtctgcgggaggggaactg
Q92843_BCL2L2-03      --------------------------------------------------
Q92843_BCL2L2-04      --------------------------------------------------
Q92843_BCL2L2-05      --------------------------------------------------

Q92843_BCL2L2-06      ggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctgg
Q92843_BCL2L2-01      --------------------------------------------------
Q92843_BCL2L2-02      ggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctgg
Q92843_BCL2L2-03      --------------------------------------------------
Q92843_BCL2L2-04      --------------------------------------------------
Q92843_BCL2L2-05      --------------------------------------------------

Q92843_BCL2L2-06      tatggagcacactcttcaccctaccctctaccacaggacacatatccctg
Q92843_BCL2L2-01      --------------------------------------------------
Q92843_BCL2L2-02      taactgtaggggccttttttgctagcaagtga------------------
Q92843_BCL2L2-03      --------------------------------------------------
Q92843_BCL2L2-04      --------------------------------------------------
Q92843_BCL2L2-05      --------------------------------------------------

Q92843_BCL2L2-06      ttagcattccccgggacctttagccaagaggagctgcagggaccatggcc
Q92843_BCL2L2-01      --------------------------------------------------
Q92843_BCL2L2-02      --------------------------------------------------
Q92843_BCL2L2-03      --------------------------------------------------
Q92843_BCL2L2-04      --------------------------------------------------
Q92843_BCL2L2-05      --------------------------------------------------

Q92843_BCL2L2-06      aggttaccaaaatgccctgctctga
Q92843_BCL2L2-01      -------------------------
Q92843_BCL2L2-02      -------------------------
Q92843_BCL2L2-03      -------------------------
Q92843_BCL2L2-04      -------------------------
Q92843_BCL2L2-05      -------------------------

© 1998-2020Legal notice