Dataset for CDS BCL-2-like of organism Coturnix japonica

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C2UCW6_BCL2A1-      atggaaaccgctgagt--------tctattacgtttattattta------
A0A8C2T2M7_BCL2L1-      atgtccggcagtaaccgggacttagtgattgactttgtttcctacaa---
A0A8C2U1A2_BCL2-01      atg-----------------------------------------------
A0A8C2TT61_MCL1-01      atgtttgccgtcaaacggaacgccgtcatcggcttcaatctctattgcgg
A0A8C2TT61_MCL1-02      atgtttgccgtcaaacggaacgccgtcatcggcttcaatctctattgcgg
                        ***                                               

A0A8C2UCW6_BCL2A1-      ---------------------gctc-------------aagattat----
A0A8C2T2M7_BCL2L1-      ---------------------gctctc-------gcagaag---------
A0A8C2U1A2_BCL2-01      ---------------------gctcacc---ccgggagaaga--------
A0A8C2TT61_MCL1-01      cggaggaggcccgggcctggtgcccgcttcaccggcaggagaccaacccg
A0A8C2TT61_MCL1-02      cggaggaggcccgggcctggtgcccgcttcaccggcaggagaccaacccg
                                             ** *              **         

A0A8C2UCW6_BCL2A1-      ------------------------------ctgcaa---------tatgt
A0A8C2T2M7_BCL2L1-      -------------------gggcactgctggagcgagctggag--gaaga
A0A8C2U1A2_BCL2-01      -------------------ggctacgacaaccgcgagatagtgctgaagt
A0A8C2TT61_MCL1-01      cgccacccgccgccgccgccgctccggccgccgcca-ccggctctgaggt
A0A8C2TT61_MCL1-02      cgccacccgccgccgccgccgctccggccgccgcca-ccggctctgaggt
                                                        ** *          * * 

A0A8C2UCW6_BCL2A1-      gcttcag-----gaatcacgtcttgg---------------------acc
A0A8C2T2M7_BCL2L1-      ggatgagaacaggactgacactgcggcagaggcagagatggac----agc
A0A8C2U1A2_BCL2-01      acatccactataaactctctcagcgg-------ggctatg-------act
A0A8C2TT61_MCL1-01      accgcggcctctgattggctcagcgg-------ggctgtgggcctccacc
A0A8C2TT61_MCL1-02      accgcggcctctgattggctcagcgg-------ggctgtgggcctccacc
                                     * *  *     **                     *  

A0A8C2UCW6_BCL2A1-      agccc-------------aaacc---------------------------
A0A8C2T2M7_BCL2L1-      gtcctcaacgg-------gagcccatcg---------------------t
A0A8C2U1A2_BCL2-01      gggct-gccggtgaggacaggccgcctg---------tgcccccggccct
A0A8C2TT61_MCL1-01      ggcctcgccg--------aagccccccgcgatcctattggctccggggct
A0A8C2TT61_MCL1-02      ggcctcgccg--------aagccccccgcgatcctattggctccggggct
                           *                 **                           

A0A8C2UCW6_BCL2A1-      ------------------------agggttgctcatgtct----------
A0A8C2T2M7_BCL2L1-      ggcacccgc-------------------ctgccggccacgtagtgaatg-
A0A8C2U1A2_BCL2-01      ggctcctgct-----------------gctgctcctgccgcggtggctgc
A0A8C2TT61_MCL1-01      gccccccactctccgattggctccggggctgccccccactctccgattgg
A0A8C2TT61_MCL1-02      gccccccactctccgattggctccggggctgccccccactctccgattgg
                                                     ***      *           

A0A8C2UCW6_BCL2A1-      --------------------------------------------------
A0A8C2T2M7_BCL2L1-      ---------------------------------------gagccaccgtg
A0A8C2U1A2_BCL2-01      tgctggagcctcctcccac-----------caccgccccgagccccccgg
A0A8C2TT61_MCL1-01      ttccgagtttgccccccactctctgattggtcccgccacggcccgccggg
A0A8C2TT61_MCL1-02      ttccgagtttgccccccactctctgattggtcccgccacggcccgccggg
                                                                          

A0A8C2UCW6_BCL2A1-      ----------------------------------tgcgaaac--------
A0A8C2T2M7_BCL2L1-      cac---------------------------------cggagc----agca
A0A8C2U1A2_BCL2-01      ctc-------------------ggctgctgctagtgaggtgcccccagct
A0A8C2TT61_MCL1-01      ctccgtcggactccacaccgaggcccgtcgctc-tgtggagccccgag--
A0A8C2TT61_MCL1-02      ctccgtcggactccacaccgaggcccgtcgctc-tgtggagccccgag--
                                                             *   *        

A0A8C2UCW6_BCL2A1-      ---------------------attgcatcttca-----------------
A0A8C2T2M7_BCL2L1-      tggaagtt-------------catgaaatcgtcggagcatctg-------
A0A8C2U1A2_BCL2-01      gaggggctgcgc---------cccgcacctccaggcgtcc----------
A0A8C2TT61_MCL1-01      gaggagttggacggatacgaacccgaatccgaacgaggccccgggggcga
A0A8C2TT61_MCL1-02      gaggagttggacggatacgaacccgaatccgaacgaggccccgggggcga
                                                * *                       

A0A8C2UCW6_BCL2A1-      -----------------ctccaagatcagacagaggaggctctcagaccc
A0A8C2T2M7_BCL2L1-      ------acgtgaggcaggcgctgagagaagcaggggatgagtttgagctg
A0A8C2U1A2_BCL2-01      ------acctcgccct-gcgccagg-----ccggggacgagttctctcgc
A0A8C2TT61_MCL1-01      ttcgttacccggtaca-ccgccagaactgcccgacgacgagctacggcg-
A0A8C2TT61_MCL1-02      ttcgttacccggtaca-ccgccagaactgcccgacgacgagctacggcg-
                                            *         * *  ** *   *    *  

A0A8C2UCW6_BCL2A1-      tttttggacaggatc--------gatatcacctc----------------
A0A8C2T2M7_BCL2L1-      aggtacaggagggct--ttcagcgacctcacctc------------ccag
A0A8C2U1A2_BCL2-01      cgctaccagagggactttgcccagatgtc--------------gggccag
A0A8C2TT61_MCL1-01      ggattccttagagctcatcctccggtatctccgggaagcggcgggagaag
A0A8C2TT61_MCL1-02      ggattccttagagctcatcctccggtatctccgggaagcggcgggagaag
                           *     **            *   **                     

A0A8C2UCW6_BCL2A1-      --------------------------------------------cgttga
A0A8C2T2M7_BCL2L1-      ctccacatcaccc-------------------------------ctggca
A0A8C2U1A2_BCL2-01      ctgcacctgacgc-------------------------------ccttca
A0A8C2TT61_MCL1-01      cggaacccagcgttaaaaagctttttccgggtctattgggtgggcctgga
A0A8C2TT61_MCL1-02      cggaacccagcgttaaaaagctttttccgggtctattgggtgggcctgga
                                                                    *    *

A0A8C2UCW6_BCL2A1-      tgtt--------gccaagagaattttcaatgg------------------
A0A8C2T2M7_BCL2L1-      cggcgt------acca----gagcttcgagca------------------
A0A8C2U1A2_BCL2-01      cggccc------acgg----tcgcttcgtggc------------------
A0A8C2TT61_MCL1-01      cggcccggtaaaacggggaacggcgtcatggagaaagcactggaaacgtt
A0A8C2TT61_MCL1-02      cggcccggtaaaacggggaacggcgtcatggagaaagcactggaaacgtt
                         *           *           **                       

A0A8C2UCW6_BCL2A1-      ------------------agtcatggaagaaa------------------
A0A8C2T2M7_BCL2L1-      ------------------ggtagtcaatgaac------------------
A0A8C2U1A2_BCL2-01      ------------------cgtggtggaggagc------------------
A0A8C2TT61_MCL1-01      gaggagggtcggggatggagtgatggagaaacacgagctggcgttccagg
A0A8C2TT61_MCL1-02      gaggagggtcggggatggagtgatggagaaacacgagctggcgttccagg
                                           **  *  *  *                    

A0A8C2UCW6_BCL2A1-      --------------------------------------------------
A0A8C2T2M7_BCL2L1-      --------------------------------------------------
A0A8C2U1A2_BCL2-01      --------------------------------------------------
A0A8C2TT61_MCL1-01      gaatgcttcggaagctggaaatcaagaaagaagaagatctgcaggcagtt
A0A8C2TT61_MCL1-02      gaatgcttcggaagctggaaatcaagaaagaagaagatctgcaggcagtt
                                                                          

A0A8C2UCW6_BCL2A1-      -------------------aatttgctgatggaaatacgaactggggacg
A0A8C2T2M7_BCL2L1-      -------------------tcttccacgatggtgt---gaactgggggcg
A0A8C2U1A2_BCL2-01      -------------------tcttccgtgatggggt---caactggggccg
A0A8C2TT61_MCL1-01      tgtgaggtggccgctcacgttttcagcgacggagtaacaaactggggccg
A0A8C2TT61_MCL1-02      tgtgaggtggccgctcacgttttcagcgacggagtaacaaactggggccg
                                             **    ** **       ******** **

A0A8C2UCW6_BCL2A1-      aattacgaccatatttacttttggaggtcttctcaccaagaagcttcaag
A0A8C2T2M7_BCL2L1-      cattgtggctttcttctccttcggaggg------gctctg-tgcgtggag
A0A8C2U1A2_BCL2-01      gattgtcgccttcttcgagttcggcggc------gtgatg-tgcgtcgag
A0A8C2TT61_MCL1-01      agttgtcacgctcatctcatttggtgcctttgttgcaaaa-cacctgaaa
A0A8C2TT61_MCL1-02      agttgtcacgctcatctcatttggtgcctttgttgcaaaa-cacctgaaa
                          **    *  *  *    ** ** *                 * *  * 

A0A8C2UCW6_BCL2A1-      agcacggagttcagctcaccggagagga-------gaaggagcagatttc
A0A8C2T2M7_BCL2L1-      agcgtgga-------ca--aggagatgcgggtactggtgggacgcattgt
A0A8C2U1A2_BCL2-01      agcgtcaa-------cc--gggagatgtcgccgctggtggacaacattgc
A0A8C2TT61_MCL1-01      agcatcaa-------ccaagagaaatgcatcagctcgttggcag------
A0A8C2TT61_MCL1-02      agcatcaa-------ccaagagaaatgcatcagctcgttggcag------
                        ***    *             ** * *            *          

A0A8C2UCW6_BCL2A1-      ttatttcatcacagagtacatcataaaca---acaaagccgcgtggatag
A0A8C2T2M7_BCL2L1-      gtcttggatgaccacgtac---ttgaccgaccatctagatccctggatcc
A0A8C2U1A2_BCL2-01      cacctggatgaccgagtac---ctgaaccggcacctgcacaactggatcc
A0A8C2TT61_MCL1-01      -----ggatcatcacagacgctttggtctcatccaaacgcgagtggctga
A0A8C2TT61_MCL1-02      -----ggatcatcacagacgctttggtctcatccaaacgcgagtggctga
                               ** *      **    *   *               *** *  

A0A8C2UCW6_BCL2A1-      atgcaaacggtggctgggaaaacggtttcct--------------aacaa
A0A8C2T2M7_BCL2L1-      aggagaatggcggctgggag---cgctttgt------------------g
A0A8C2U1A2_BCL2-01      aggacaacgggggatgggat---gccttcgt------------------g
A0A8C2TT61_MCL1-01      tgagccagggaggctgggag---ggttttgtcgacttcttccgagtcgag
A0A8C2TT61_MCL1-02      tgagccagggaggctgggag---ggttttgtcgacttcttccgagtcgag
                              * ** ** *****       **  *                   

A0A8C2UCW6_BCL2A1-      agtttgaa-------------------------agaagatcaccactgtc
A0A8C2T2M7_BCL2L1-      gacctgtatgggaataatgctgctgccgagctgaggaagggccaggagac
A0A8C2U1A2_BCL2-01      gaattgtacggcaacagt---------------atga----------ggc
A0A8C2TT61_MCL1-01      gacctggaaggcagcatc---------------aggaacgtgctgatggc
A0A8C2TT61_MCL1-02      gacctggaaggcagcatc---------------aggaacgtgctgatggc
                            ** *                         *  *          * *

A0A8C2UCW6_BCL2A1-      tttctctacaat---------------tacagacatatttgcagctgttt
A0A8C2T2M7_BCL2L1-      cttcaacaaatggctcct-------------gacc---------------
A0A8C2U1A2_BCL2-01      ctttgttcgatttctcctggatctctctgaagaccatcctgagcctggtt
A0A8C2TT61_MCL1-01      ctttgctggagt-------------------ggccggcctg---------
A0A8C2TT61_MCL1-02      ctttgctggagt-------------------ggccggcctg---------
                         **      *                     * *                

A0A8C2UCW6_BCL2A1-      tt-------------------tccttgttcagagagtactactga-----
A0A8C2T2M7_BCL2L1-      --ggggcgaccgtggccggagttcttctgctgggatccctgctgagccgc
A0A8C2U1A2_BCL2-01      ctggtgggagcttgcat----cactcttggcgcttatcttg----gacac
A0A8C2TT61_MCL1-01      --ggggcgagcttggcc----tacatgatccgaaagtggag----gagtt
A0A8C2TT61_MCL1-02      --ggggcgagcttggcc----tacatgatccgc------tg----gactt
                                               *       *                  

A0A8C2UCW6_BCL2A1-      ------
A0A8C2T2M7_BCL2L1-      aagtga
A0A8C2U1A2_BCL2-01      aagtag
A0A8C2TT61_MCL1-01      ga----
A0A8C2TT61_MCL1-02      ga----
                              

© 1998-2022Legal notice