Dataset for CDS BCL-2-like of organism Coturnix japonica

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A8C2T2M7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Coturnix japonica GN=BCL2L1 (length=690 residues).
atgtccggcagtaaccgggacttagtgattgactttgtttcctacaagctctcgcagaaggggcactgctggagcgagct
ggaggaagaggatgagaacaggactgacactgcggcagaggcagagatggacagcgtcctcaacgggagcccatcgtggc
acccgcctgccggccacgtagtgaatggagccaccgtgcaccggagcagcatggaagttcatgaaatcgtcggagcatct
gacgtgaggcaggcgctgagagaagcaggggatgagtttgagctgaggtacaggagggctttcagcgacctcacctccca
gctccacatcacccctggcacggcgtaccagagcttcgagcaggtagtcaatgaactcttccacgatggtgtgaactggg
ggcgcattgtggctttcttctccttcggaggggctctgtgcgtggagagcgtggacaaggagatgcgggtactggtggga
cgcattgtgtcttggatgaccacgtacttgaccgaccatctagatccctggatccaggagaatggcggctgggagcgctt
tgtggacctgtatgggaataatgctgctgccgagctgaggaagggccaggagaccttcaacaaatggctcctgaccgggg
cgaccgtggccggagttcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A8C2TT61_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Coturnix japonica GN=MCL-1 (length=1056 residues).
atgtttgccgtcaaacggaacgccgtcatcggcttcaatctctattgcggcggaggaggcccgggcctggtgcccgcttc
accggcaggagaccaacccgcgccacccgccgccgccgccgctccggccgccgccaccggctctgaggtaccgcggcctc
tgattggctcagcggggctgtgggcctccaccggcctcgccgaagccccccgcgatcctattggctccggggctgccccc
cactctccgattggctccggggctgccccccactctccgattggttccgagtttgccccccactctctgattggtcccgc
cacggcccgccgggctccgtcggactccacaccgaggcccgtcgctctgtggagccccgaggaggagttggacggatacg
aacccgaatccgaacgaggccccgggggcgattcgttacccggtacaccgccagaactgcccgacgacgagctacggcgg
gattccttagagctcatcctccggtatctccgggaagcggcgggagaagcggaacccagcgttaaaaagctttttccggg
tctattgggtgggcctggacggcccggtaaaacggggaacggcgtcatggagaaagcactggaaacgttgaggagggtcg
gggatggagtgatggagaaacacgagctggcgttccagggaatgcttcggaagctggaaatcaagaaagaagaagatctg
caggcagtttgtgaggtggccgctcacgttttcagcgacggagtaacaaactggggccgagttgtcacgctcatctcatt
tggtgcctttgttgcaaaacacctgaaaagcatcaaccaagagaaatgcatcagctcgttggcagggatcatcacagacg
ctttggtctcatccaaacgcgagtggctgatgagccagggaggctgggagggttttgtcgacttcttccgagtcgaggac
ctggaaggcagcatcaggaacgtgctgatggcctttgctggagtggccggcctgggggcgagcttggcctacatgatccg
aaagtggaggagttga
>gnl|bcl2dbcds|A0A8C2TT61_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Coturnix japonica GN=MCL-1 (length=1050 residues).
atgtttgccgtcaaacggaacgccgtcatcggcttcaatctctattgcggcggaggaggcccgggcctggtgcccgcttc
accggcaggagaccaacccgcgccacccgccgccgccgccgctccggccgccgccaccggctctgaggtaccgcggcctc
tgattggctcagcggggctgtgggcctccaccggcctcgccgaagccccccgcgatcctattggctccggggctgccccc
cactctccgattggctccggggctgccccccactctccgattggttccgagtttgccccccactctctgattggtcccgc
cacggcccgccgggctccgtcggactccacaccgaggcccgtcgctctgtggagccccgaggaggagttggacggatacg
aacccgaatccgaacgaggccccgggggcgattcgttacccggtacaccgccagaactgcccgacgacgagctacggcgg
gattccttagagctcatcctccggtatctccgggaagcggcgggagaagcggaacccagcgttaaaaagctttttccggg
tctattgggtgggcctggacggcccggtaaaacggggaacggcgtcatggagaaagcactggaaacgttgaggagggtcg
gggatggagtgatggagaaacacgagctggcgttccagggaatgcttcggaagctggaaatcaagaaagaagaagatctg
caggcagtttgtgaggtggccgctcacgttttcagcgacggagtaacaaactggggccgagttgtcacgctcatctcatt
tggtgcctttgttgcaaaacacctgaaaagcatcaaccaagagaaatgcatcagctcgttggcagggatcatcacagacg
ctttggtctcatccaaacgcgagtggctgatgagccagggaggctgggagggttttgtcgacttcttccgagtcgaggac
ctggaaggcagcatcaggaacgtgctgatggcctttgctggagtggccggcctgggggcgagcttggcctacatgatccg
ctggacttga
>gnl|bcl2dbcds|A0A8C2U1A2_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Coturnix japonica GN=BCL-2 (length=702 residues).
atggctcaccccgggagaagaggctacgacaaccgcgagatagtgctgaagtacatccactataaactctctcagcgggg
ctatgactgggctgccggtgaggacaggccgcctgtgcccccggccctggctcctgctgctgctcctgccgcggtggctg
ctgctggagcctcctcccaccaccgccccgagccccccggctcggctgctgctagtgaggtgcccccagctgaggggctg
cgccccgcacctccaggcgtccacctcgccctgcgccaggccggggacgagttctctcgccgctaccagagggactttgc
ccagatgtcgggccagctgcacctgacgcccttcacggcccacggtcgcttcgtggccgtggtggaggagctcttccgtg
atggggtcaactggggccggattgtcgccttcttcgagttcggcggcgtgatgtgcgtcgagagcgtcaaccgggagatg
tcgccgctggtggacaacattgccacctggatgaccgagtacctgaaccggcacctgcacaactggatccaggacaacgg
gggatgggatgccttcgtggaattgtacggcaacagtatgaggcctttgttcgatttctcctggatctctctgaagacca
tcctgagcctggttctggtgggagcttgcatcactcttggcgcttatcttggacacaagtag
>gnl|bcl2dbcds|A0A8C2UCW6_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Coturnix japonica GN=BCL2A1 (length=525 residues).
atggaaaccgctgagttctattacgtttattatttagctcaagattatctgcaatatgtgcttcaggaatcacgtcttgg
accagcccaaaccagggttgctcatgtcttgcgaaacattgcatcttcactccaagatcagacagaggaggctctcagac
cctttttggacaggatcgatatcacctccgttgatgttgccaagagaattttcaatggagtcatggaagaaaaatttgct
gatggaaatacgaactggggacgaattacgaccatatttacttttggaggtcttctcaccaagaagcttcaagagcacgg
agttcagctcaccggagaggagaaggagcagatttcttatttcatcacagagtacatcataaacaacaaagccgcgtgga
tagatgcaaacggtggctgggaaaacggtttcctaacaaagtttgaaagaagatcaccactgtctttctctacaattaca
gacatatttgcagctgttttttccttgttcagagagtactactga
© 1998-2022Legal notice