Dataset for CDS Unclassified of Organism Haplochromis burtoni

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|A0A3Q2VBS4_uncBCLWAV-01 Putative BCL2 homolog found in water-living anamniote vertebrates gene OS=[Eukaryota] Haplochromis burtoni (length=447 residues).
atgggagtcctgaacaaagaggcactgagcgtcaacagtcctgaccgtctggttagagaagcttttctaatgacttatga
ttacatagacaaaccactccttactcccttccccatcttccaggatgtgacagagaacacagcctgcctgatcctcatat
gtatcctggacgagcacttccttccccctacacctggaacaaagcgccgggacctggcctggagcaccgtactgagcact
gtactgtctgtacatgtgctagctggccagagggctatacactgtcatgacagtggcgatggtgatggtgcagcccgtgg
gatgttcgagtgtgggtttgtgtatcactttttggaaaagcaggacctggtttgccagctggacaaggttccacctacat
tttgtggaagagaatgtcttagccaacactgccccctactgacttaa
>gnl|bcl2dbcds|A0A3Q2WRH9_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Haplochromis burtoni (length=534 residues).
atgttaagctcagagttagggtcacgggtacctaattgtgtgttctctaacagagtcatagaggaagagctgaaggatgt
gccctcagaggatgtcccgcctctcactccactggctgtggaggggaagactgagcaggaggagaagctggtcaagcagc
tgagcaaaatgatacgtatcgtcggtgacagagtgcagttgcttacattgtggctgttctgttgcagtgtgatagatggt
gtggcttctggctctggctccaagtcagagaacttcagacgagtggcagacaaagtgtttgaggacggcatcacctggga
gagaatcgctgtgctcatctatgtagccggcaggcttgctgtcaaggtgagttgtgatttcattgttattttagcatcat
tagtagggatgggaactgagaaccagttttctacagaagcagttcctggtagttcagatcctttcaatagggcttcggag
ttgacatcacgcccttgcctatcaattctgcttatgagttctacagtcagctga
© 1998-2023Legal notice