Dataset for CDS Unclassified of Organism Labrus bergylta

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|A0A3Q3ER51_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Labrus bergylta (length=606 residues).
atgttttgtgaaggaaaccgcatgtcagatgtaaggataggggaggccttgatcaaagaggtcatacaggaggaactgaa
ggattttccctctgaggaaatcccacccctcacccaactggctatagacgggaagactgtacaggaggagcagaagctgg
tgtaccagctggcattattgacccgcaaaattggggacggactcaacgctgagtatcaggatttgatcgatggtgtggct
cgttgccctggttctaagtgggagagatttaaggaagtggcagacgtagtgttcaaagatggtatcaactgggggaggat
cgttatgctcttctatgttgctgggaagctggctgttaagatggttgaggttcatctccctcagtcagtgagggacgtcc
ttaaatggactttggatttcttcaaaaacaatctactgggctggattgtggaacatggaggatggatcagcagcttctct
gagctggcagtggcgtctgtgcaaagcgtgtcatcagtgaactccatcacctgcggccttgtcctcttcgctgccggcct
ggctattggaagtgtcatcacttggaaactgactagacaactctga
>gnl|bcl2dbcds|A0A3Q3NRK5_uncBCLWAV-01 Putative BCL2 homolog found in water-living anamniote vertebrates gene OS=[Eukaryota] Labrus bergylta (length=612 residues).
atgtgccagttggaggagccagaagccagactgggcctgaacagtcctgacccggtggtgagagaggctttcctgatggt
ccatgactacatagactacgtgaccacagggggggcagatggcacgatgggtcctgccccgacagcctgcactgccgccc
tgcgccacgccggggacgagctcctcaaccgcttccccatcttcttccgtcgctggcctcgtatcttccaggacgtgacc
gagaactcggcctgctccatgctcacaggcatcctggatgagcacttcttccctccggtccctagggggcgcaataggga
gctggcctggagcgcggtgctgtctgtgtatgtgctggccggacagatggctctgcactgccacgagaggggcatgctgg
gggtcctgcctcagctgaaggagagcataggggcgtatgtggagagggtcatctgccctgacatacgggagaagggagga
tggagcggctttgtgtcccgctttggagcgaagcagggcttggagagccaggtgaagaaggtgtgctgttggactctgct
ggccttggctgtgagcatcctcacatactgcgtttggaagagagtggtttag
© 1998-2023Legal notice