Dataset for CDS BCL-2-like of organism Vombatus ursinus

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A4X2KFL7_BCL2A1-      atggct--------------------------------------------
A0A4X2L5Q0_BCL2-01      atggctcaccctggaagaagagggtacgataatcgggagatagtgatgaa
A0A4X2JXQ8_BCL2L1-      atgtca------------------cacggcaaccgggagctggtggttga
A0A4X2KZ04_BCL2L1-      --------------------------------------------------
A0A4X2LP96_BCL2L2-      atg-----------------------------------------------
A0A4X2K2M5_BCL2L10      atggac------------------tacaa---------------------
A0A4X2LDA7_MCL1-01      atg-----------------------------------------------

A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A4X2L5Q0_BCL2-01      gtacattcattataagttgtcacagagagggtacg------agtgggatg
A0A4X2JXQ8_BCL2L1-      ctttctttcttacaagctctcacagaaaggatacagttggagtcagtttg
A0A4X2KZ04_BCL2L1-      -----------------cctca----------------------------
A0A4X2LP96_BCL2L2-      ---------------------------------gc---------------
A0A4X2K2M5_BCL2L10      -----------gtgtgcccttcgggaagagacagc---------------
A0A4X2LDA7_MCL1-01      -----------ttaggcccttttaagaagaacgcc---------------

A0A4X2KFL7_BCL2A1-      -------------gattatgaattccattatgtt--------cacatgtt
A0A4X2L5Q0_BCL2-01      ctggaaatctgagggcaccagcctctccaagccttcctt---ctgttgtt
A0A4X2JXQ8_BCL2L1-      aagatgagaataggactgaggccccagaagggacagaaatacctagtact
A0A4X2KZ04_BCL2L1-      -------------aactccggccccagaagggacagaaa---ctagtact
A0A4X2LP96_BCL2L2-      -------------gactccagcctcag---------------ccccagat
A0A4X2K2M5_BCL2L10      -------------g----------caa---------------c-----tt
A0A4X2LDA7_MCL1-01      -------------gtcatcggcctcaa---------------cctctact
                                                *                 *      *

A0A4X2KFL7_BCL2A1-      agcccaggactacttgaagt------------------atgttcaacaga
A0A4X2L5Q0_BCL2-01      gcttctgcccctgctgttgg----ggtcttctctacccagccaagacata
A0A4X2JXQ8_BCL2L1-      ------------gtgaatgg---------------------t--------
A0A4X2KZ04_BCL2L1-      ------------gtgaatgg---------------------t--------
A0A4X2LP96_BCL2L2-      actcgagccctggtggcaga------------------------------
A0A4X2K2M5_BCL2L10      ------------gtggcgga------------ctacctggat--------
A0A4X2LDA7_MCL1-01      ------------gtggaggggctagcgctccttcatccggct--------

A0A4X2KFL7_BCL2A1-      tgccacaactgggatcgtgtctaaataagacatctcaaatacta------
A0A4X2L5Q0_BCL2-01      cacctctgcctgctgaaccccaggacttggccacttctacgactgctgct
A0A4X2JXQ8_BCL2L1-      agcccctcttggcaccctgctgacagccatgc------------------
A0A4X2KZ04_BCL2L1-      agcccctcttggcaccctgctgacaaccatgc------------------
A0A4X2LP96_BCL2L2-      ---ttttgtgggttacaagctaagg------c------------------
A0A4X2K2M5_BCL2L10      tactgctgccg-------------------cc------------------
A0A4X2LDA7_MCL1-01      cgcccctgctggttcctggcaaaggaacgacc------------------

A0A4X2KFL7_BCL2A1-      ---caaaaagttgctttctctgttcaaggagaagttgaaaaggatatgga
A0A4X2L5Q0_BCL2-01      gctagaaactcacctttgcctcctcctcctgccgttgctgctgctactgc
A0A4X2JXQ8_BCL2L1-      ---agtgagt----------------------ggggccacaggacacagc
A0A4X2KZ04_BCL2L1-      ---agtgagt----------------------ggggccacaggacacagc
A0A4X2LP96_BCL2L2-      ---agaaaggctatgcc---------------tgtggaactggcccagga
A0A4X2K2M5_BCL2L10      ---gggaaggcttc--------------------------------cagg
A0A4X2LDA7_MCL1-01      ---gtggagagttcggcgccgcggcgcgacggcggggaagtggaagcggg
                               *                                        * 

A0A4X2KFL7_BCL2A1-      aacatgcttgagcactttggatattgcttctgtagattctgcca------
A0A4X2L5Q0_BCL2-01      tgcc-gctggacctgct-----gtcagtccagtgccacctgtgg------
A0A4X2JXQ8_BCL2L1-      agca-gcctggatgcccatgagacaataccagtggctgctgtgaagcaa-
A0A4X2KZ04_BCL2L1-      agca-gcctggatgcccatgagacaataccagtggctgctgtgaagcaa-
A0A4X2LP96_BCL2L2-      gagg-gc-------cct-----acaactg-agcccctgcaccgg------
A0A4X2K2M5_BCL2L10      aacg-gc-----cgcct-----actaccccagctgcagctacga------
A0A4X2LDA7_MCL1-01      gacg-acgacgacgtct-----gcggcggcggcggcggccggggagttaa
                              *                        *      *           

A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A4X2L5Q0_BCL2-01      --------------------------------------------------
A0A4X2JXQ8_BCL2L1-      --------------------------------------------------
A0A4X2KZ04_BCL2L1-      --------------------------------------------------
A0A4X2LP96_BCL2L2-      --------------------------------------------------
A0A4X2K2M5_BCL2L10      --------------------------------------------------
A0A4X2LDA7_MCL1-01      ttagcggaagcggtggcgcgagtctcccggacctggtgccgggcgtccgg

A0A4X2KFL7_BCL2A1-      ---------------------------gaagaattttcaaaagcgttat-
A0A4X2L5Q0_BCL2-01      --tccacctgacccttcgtcaagctggagatgatttctctcgaaggtacc
A0A4X2JXQ8_BCL2L1-      ----------gctttgagggaggcaggagatgaatttgaactccggtacc
A0A4X2KZ04_BCL2L1-      ----------gctttgaaggaggcaggagatgaatttgaactctggtacc
A0A4X2LP96_BCL2L2-      ----------gccatgcgagctgctggagatgagtttgagtcccgcttcc
A0A4X2K2M5_BCL2L10      --------------tgcgctcggtggcaaaagagctccgcaggcgttacc
A0A4X2LDA7_MCL1-01      gggcccccgcggaccgcgctcattggcgcggaggttc--ccgacgtcacc
                                                           *        *     

A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A4X2L5Q0_BCL2-01      g--------------gagagactttgatgaaatgtcaggt----------
A0A4X2JXQ8_BCL2L1-      g--------------acgggccttcagtgacctgacatcc----------
A0A4X2KZ04_BCL2L1-      g--------------atgggccttcagtgacctgacatcc----------
A0A4X2LP96_BCL2L2-      a--------------acgcacattttctgatctggctgct----------
A0A4X2K2M5_BCL2L10      a-------------------------------------------------
A0A4X2LDA7_MCL1-01      gccaccacaccgggaccgttgttcttctcgcggagctgccgcttctcctt

A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A4X2L5Q0_BCL2-01      ---------------------cagctgcacctgacccctgttactgctag
A0A4X2JXQ8_BCL2L1-      ---------------------cagctccacatcactccagggacggctta
A0A4X2KZ04_BCL2L1-      ---------------------ca---------------------------
A0A4X2LP96_BCL2L2-      ---------------------caattgcatgtgactcctggctcagctca
A0A4X2K2M5_BCL2L10      ------------------agacttcttcgagtgcgcccagaatcagctac
A0A4X2LDA7_MCL1-01      gcccgccgccggggccgcggacgccgtcacgtcccccgaggacgagctgg

A0A4X2KFL7_BCL2A1-      -------------------------------ggaaaagga----------
A0A4X2L5Q0_BCL2-01      gggacgctttgccacagt-------------ggtggagga----------
A0A4X2JXQ8_BCL2L1-      tcagagctt----tgagc------------aggtagtgaatga-------
A0A4X2KZ04_BCL2L1-      ------ctt----tgagc------------aggtagtgaatga-------
A0A4X2LP96_BCL2L2-      gcagcgctttacccaagt---------ctcagatga--------------
A0A4X2K2M5_BCL2L10      tcgaccagtcgcctgaacaagtcataatcgaggtagcgga----------
A0A4X2LDA7_MCL1-01      acggctacgagcccgagc-------cccccgggaagcggcccgcccgccg

A0A4X2KFL7_BCL2A1-      ---------------atttg---------aggatggcattattaactggg
A0A4X2L5Q0_BCL2-01      ---------------gttgtt---ca---gggatgg---ggtgaactggg
A0A4X2JXQ8_BCL2L1-      ---------------actctt---tc---gggatgg---ggtgaactggg
A0A4X2KZ04_BCL2L1-      ---------------gctctt---tc---gggatag---ggtgaactggg
A0A4X2LP96_BCL2L2-      ---------------gctctt---cc---agggggg---gcccaactggg
A0A4X2K2M5_BCL2L10      ---------------gctcatgagcc---agggcga---attcaactggg
A0A4X2LDA7_MCL1-01      gtcgctgctggccctgcccttggcccgagagggcgg---ggacacctcga
                                                      **           * ** * 

A0A4X2KFL7_BCL2A1-      gacgtattgtcaccatatttgcttttgggggaattctcatcaagaaactt
A0A4X2L5Q0_BCL2-01      ggcggatcgtggccttctttgaatttggtggtgtcatgtgtgtggagagc
A0A4X2JXQ8_BCL2L1-      gccgaattgtggcattcttctccttcggaggggcactgtgtgtggaaagc
A0A4X2KZ04_BCL2L1-      gccgaattgtggcattcttctccttcggaggagcattgtgtgtggaacgc
A0A4X2LP96_BCL2L2-      gccgtcttgtggcattcttcgtctttggggcagcgctgtgtgcagagagc
A0A4X2K2M5_BCL2L10      gccgggtggcagtgctggtggtttttgccggggcactgc-tggagatgga
A0A4X2LDA7_MCL1-01      gcagcgc-ccacggctcgctgccctcgacgccgccctccgtcgaggagga
                        *  *           *        * *  *      *             

A0A4X2KFL7_BCL2A1-      ctga----------------------------------------------
A0A4X2L5Q0_BCL2-01      gtca----------accgg-------------------------------
A0A4X2JXQ8_BCL2L1-      gtgg----------ataag-------------------------------
A0A4X2KZ04_BCL2L1-      gtgg----------ataag-------------------------------
A0A4X2LP96_BCL2L2-      gtca----------acaaa-------------------------------
A0A4X2K2M5_BCL2L10      ggaa------ccgcagaaagag----------------------------
A0A4X2LDA7_MCL1-01      ggaagacgagctgtacgagcagtccctggagctgatcacctggtacctgc

A0A4X2KFL7_BCL2A1-      gacatagatctccactgactatgagtactcatgaagaagtttcttatttt
A0A4X2L5Q0_BCL2-01      gagatgtc---------gcccctggtg-----gacagcattgccctgtgg
A0A4X2JXQ8_BCL2L1-      gagatgga---------agtcttggta-----ggacgaatcacctcctgg
A0A4X2KZ04_BCL2L1-      gagatgga---------agtcttggta-----ggacgaatcacctcctgg
A0A4X2LP96_BCL2L2-      gagatgga---------accactggtg-----ggacagg-----tgcagg
A0A4X2K2M5_BCL2L10      gagagagt---------acagccgctt-----cggaggg-----aaatga
A0A4X2LDA7_MCL1-01      gcgagcag---------gcggccggca-----ccaagga-----cgccaa
                        *  *                                              

A0A4X2KFL7_BCL2A1-      attgctgagttcataatgaacaacatagcagagtggataagacaaaa---
A0A4X2L5Q0_BCL2-01      atgactgagtacctgaaccggcacctgcacaactggatccaggataa---
A0A4X2JXQ8_BCL2L1-      atggccacttacttggatgaccacctagacccttggatccaagaaaa---
A0A4X2KZ04_BCL2L1-      atggccacttacttggatgaccacctagacccttggatctcagaaaa---
A0A4X2LP96_BCL2L2-      actggatggtgaccta-----cctagagacccagc------tggcagatt
A0A4X2K2M5_BCL2L10      gccggcgcttgacggaagaactctgca-actatctggtg-gagaagaagg
A0A4X2LDA7_MCL1-01      gcccctgcgtagcgggaaggctctggagaccctgcggcgcgtggcggacg

A0A4X2KFL7_BCL2A1-      -----------------------------------------cggaggatg
A0A4X2L5Q0_BCL2-01      -----------------------------------------tggaggatg
A0A4X2JXQ8_BCL2L1-      -----------------------------------------tggcggttg
A0A4X2KZ04_BCL2L1-      -----------------------------------------tggcggttg
A0A4X2LP96_BCL2L2-      ggatccacagcag----------------------------cgggggctg
A0A4X2K2M5_BCL2L10      gc-----gcgtggctgcagga------------gca-----cggaggctg
A0A4X2LDA7_MCL1-01      gcgtccagcgcaaccacgagacggctttccaaggcatgcttcggaagctg
                                                                  **  * **

A0A4X2KFL7_BCL2A1-      ggaaa---------------------------------------------
A0A4X2L5Q0_BCL2-01      ggtagcaaaggttttctctatgt---------------------------
A0A4X2JXQ8_BCL2L1-      gg------------------------------------------------
A0A4X2KZ04_BCL2L1-      gg------------------------------------------------
A0A4X2LP96_BCL2L2-      ggc-----------------------------------------------
A0A4X2K2M5_BCL2L10      gac-----------------------------------------------
A0A4X2LDA7_MCL1-01      gacatcaagaatgaagaggatattaaagctgtgtctcgagtggtaacttg

A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A4X2L5Q0_BCL2-01      --------------------------------------tttcctttactt
A0A4X2JXQ8_BCL2L1-      ----------------------------------------------acac
A0A4X2KZ04_BCL2L1-      ----------------------------------------------acac
A0A4X2LP96_BCL2L2-      ---------------------------------------ggaattcacgg
A0A4X2K2M5_BCL2L10      --------------------------------------tggctttcacca
A0A4X2LDA7_MCL1-01      tgtgttcagtgatggagtaacgaattggggccggattgtgactctcattt

A0A4X2KFL7_BCL2A1-      ------atggcttcgtaaagaattttgaacctaatatggtgtggccaaac
A0A4X2L5Q0_BCL2-01      ttctttcccccttccctttcac----------------------------
A0A4X2JXQ8_BCL2L1-      cttcgtggagctttatgggaatgatgcagctgcagagag------ccgga
A0A4X2KZ04_BCL2L1-      ctttgcggagccttatgagaataacgcagctgcggagag------ccggg
A0A4X2LP96_BCL2L2-      ct--------ctgtacggggat---ggggccctggagga--------ggc
A0A4X2K2M5_BCL2L10      cc-------acttcacccaaaa---gcagtctt-----------ccccac
A0A4X2LDA7_MCL1-01      cttttggtgcctttgtggcaaa---gca--cttaaagagcataaaccagg
                                  *         *                             

A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A4X2L5Q0_BCL2-01      -----------accccactggacgacccctt-------------------
A0A4X2JXQ8_BCL2L1-      agggc---------------caggaacgcttcaaccgatggctg------
A0A4X2KZ04_BCL2L1-      agggc---------------caggaaagcttcatccgatggctg------
A0A4X2LP96_BCL2L2-      aaggc-------gtctgcgggaggggaactgggcctcagtgc-gaacagt
A0A4X2K2M5_BCL2L10      aaagt------gatcca--agcagtaccc--------tgtgctgtataa-
A0A4X2LDA7_MCL1-01      aaagttgcatagacccactagcagaaagcctaacagatgtactggtcaag

A0A4X2KFL7_BCL2A1-      -----------ttcacggatatttcaacaaagatctggggtgt-------
A0A4X2L5Q0_BCL2-01      -------------------tccatcaacgtggtttcaaagtattgttgca
A0A4X2JXQ8_BCL2L1-      -----------ctgactggcatgacagtgg------------ctggtg--
A0A4X2KZ04_BCL2L1-      -----------ctgactggcatgacagtgg------------ctggtg--
A0A4X2LP96_BCL2L2-      gctaacaggggctg-------tggca-------ttgggggctctggtg--
A0A4X2K2M5_BCL2L10      ------------tggccg---cagcagcaggatttgga----ctggtggg
A0A4X2LDA7_MCL1-01      acaaaaagggactggctgatcaagcaaaagggctgggaggggtttgtgga

A0A4X2KFL7_BCL2A1-      attttcctttctg-------------------------------------
A0A4X2L5Q0_BCL2-01      agtgaagcattta---------------------------------ctaa
A0A4X2JXQ8_BCL2L1-      --tagtcctactg-----------------------------gggtccct
A0A4X2KZ04_BCL2L1-      --tagtcctgctg-----------------------------gggtccct
A0A4X2LP96_BCL2L2-      -------------------------------------actgtgggggcct
A0A4X2K2M5_BCL2L10      attagctcttcta-------------------------------------
A0A4X2LDA7_MCL1-01      attctttcatgtagaggacctagaaggtggcatcagaaatgtgctgctcg

A0A4X2KFL7_BCL2A1-      -----------------------------------------------aag
A0A4X2L5Q0_BCL2-01      cttgtgccttc---------------------------------------
A0A4X2JXQ8_BCL2L1-      attcagccgg-------------------------------------aag
A0A4X2KZ04_BCL2L1-      attcagccgg-------------------------------------aag
A0A4X2LP96_BCL2L2-      tctttgccagc------------------------------------aag
A0A4X2K2M5_BCL2L10      --ttagccg------------------------------------tacga
A0A4X2LDA7_MCL1-01      cctttgccggtgttgctggagtaggagctggtttggcatatctaataaga

A0A4X2KFL7_BCL2A1-      taa
A0A4X2L5Q0_BCL2-01      tga
A0A4X2JXQ8_BCL2L1-      tga
A0A4X2KZ04_BCL2L1-      tga
A0A4X2LP96_BCL2L2-      tga
A0A4X2K2M5_BCL2L10      taa
A0A4X2LDA7_MCL1-01      tag

© 1998-2021Legal notice