Dataset for CDS BCL-2-like of organism Suricata suricatta

[Download (right click)] [Alignment] [Repertoires]

10 sequence(s)

>gnl|bcl2dbcds|A0A673TBH1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Suricata suricatta GN=MCL-1 (length=1482 residues).
atgtttggcctcaagaggaacgccgtaatcggactcaacctctactgtgggggggccgggttgggggccgggagtggcgg
cgcctcctcttcgggaggggggcttttagccgtagggaaggaggccacggcccggcgggaggtagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcgagccccccggccacttttgcgcccgacgcccggagggtcgcgcggccctcg
cccattggcgccgagggccccgacgtcacggctacctccccgaagctgctgttctatgcggccacccgctgtgcgtcgcc
gcctgaagagatggaaggccccgcggccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggaaccct
tggggaagcggccggccgtcctgcctttgctggagctggtcggggaggccagcggtggccccggcacggacggctcactg
ccctcgacgccacccccggtggaggaggaggaggacgagttgttccggcagtcgttagagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacgggaagccactgggcgggtccggggcggccagccgaaaggcgttagagaccctgc
gccgggtcggcgacggcgtacagcgaaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggccaaacatttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttctcgtaaggacgaaacgagactggctagtcaaacaaagaggctgggcacagggacccctggaagtctgg
cttctggaagtggagacctggactcagacctcagaattgccggggtcagataaaggggtcccaggctgcaggctcgcatg
tcaggggggcggcctcccggcgcacaggtctgctcacttgtacctactctggcttcctcctggctcaacccatgggcctc
cccactcccaaggcagactacggaccgtcgctggattcctgtcccacactcagcagagcactgttgaggaagtgatggcg
aactcgccgactcctctggccgcgcccacaccgcacggagcactgagggtaggagagcctcccagagcctggattcgcag
gcatcctcccgctcctccagttccagggcctttgacccaggacctgcctcagtccctgcctggccaattacgtgactctg
tgtgctggagggcaggctgggcatgtggctctgggccccaacccctggctcagtgtcttatctgctttatggatgggggc
tgcacaagagatctcattcatgaaaaagcttctgctgattaa
>gnl|bcl2dbcds|A0A673TBH1_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Suricata suricatta GN=MCL-1 (length=1029 residues).
atgtttggcctcaagaggaacgccgtaatcggactcaacctctactgtgggggggccgggttgggggccgggagtggcgg
cgcctcctcttcgggaggggggcttttagccgtagggaaggaggccacggcccggcgggaggtagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcgagccccccggccacttttgcgcccgacgcccggagggtcgcgcggccctcg
cccattggcgccgagggccccgacgtcacggctacctccccgaagctgctgttctatgcggccacccgctgtgcgtcgcc
gcctgaagagatggaaggccccgcggccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggaaccct
tggggaagcggccggccgtcctgcctttgctggagctggtcggggaggccagcggtggccccggcacggacggctcactg
ccctcgacgccacccccggtggaggaggaggaggacgagttgttccggcagtcgttagagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacgggaagccactgggcgggtccggggcggccagccgaaaggcgttagagaccctgc
gccgggtcggcgacggcgtacagcgaaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggccaaacatttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttctcgtaaggacgaaacgagactggctagtcaaacaaagaggctgggcacagggacccctggaagtctgg
cttctggaagtggagacctggactcagacctcagaattgccggggtcagataaaggttccctgctttag
>gnl|bcl2dbcds|A0A673TBH1_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Suricata suricatta GN=MCL-1 (length=1086 residues).
atgtttggcctcaagaggaacgccgtaatcggactcaacctctactgtgggggggccgggttgggggccgggagtggcgg
cgcctcctcttcgggaggggggcttttagccgtagggaaggaggccacggcccggcgggaggtagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcgagccccccggccacttttgcgcccgacgcccggagggtcgcgcggccctcg
cccattggcgccgagggccccgacgtcacggctacctccccgaagctgctgttctatgcggccacccgctgtgcgtcgcc
gcctgaagagatggaaggccccgcggccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggaaccct
tggggaagcggccggccgtcctgcctttgctggagctggtcggggaggccagcggtggccccggcacggacggctcactg
ccctcgacgccacccccggtggaggaggaggaggacgagttgttccggcagtcgttagagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacgggaagccactgggcgggtccggggcggccagccgaaaggcgttagagaccctgc
gccgggtcggcgacggcgtacagcgaaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggccaaacatttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttctcgtaaggacgaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggcacagggacccctggaagtctggcttctgg
aagtggagacctggactcagacctcagaattgccggggtcagataa
>gnl|bcl2dbcds|A0A673TBH1_MCL1-04 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Suricata suricatta GN=MCL-1 (length=1053 residues).
atgtttggcctcaagaggaacgccgtaatcggactcaacctctactgtgggggggccgggttgggggccgggagtggcgg
cgcctcctcttcgggaggggggcttttagccgtagggaaggaggccacggcccggcgggaggtagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcgagccccccggccacttttgcgcccgacgcccggagggtcgcgcggccctcg
cccattggcgccgagggccccgacgtcacggctacctccccgaagctgctgttctatgcggccacccgctgtgcgtcgcc
gcctgaagagatggaaggccccgcggccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggaaccct
tggggaagcggccggccgtcctgcctttgctggagctggtcggggaggccagcggtggccccggcacggacggctcactg
ccctcgacgccacccccggtggaggaggaggaggacgagttgttccggcagtcgttagagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacgggaagccactgggcgggtccggggcggccagccgaaaggcgttagagaccctgc
gccgggtcggcgacggcgtacagcgaaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggccaaacatttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttctcgtaaggacgaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A673TBH1_MCL1-05 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Suricata suricatta GN=MCL-1 (length=594 residues).
atgtttggcctcaagaggaacgccgtaatcggactcaacctctactgtgggggggccgggttgggggccgggagtggcgg
cgcctcctcttcgggaggggggcttttagcgaccggcgccaaggacgggaagccactgggcgggtccggggcggccagcc
gaaaggcgttagagaccctgcgccgggtcggcgacggcgtacagcgaaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggccaaacatttgaagagtataaaccaagaaagctgca
tcgaaccattagcagaaagcatcacagatgttctcgtaaggacgaaacgagactggctagtcaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A673TDC6_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Suricata suricatta GN=BCL2A1 (length=951 residues).
atggcggacggcgagttcgggttcgtcctcacgctggcccaggactacatggggcacgtcctgcaggtgccgccgccgca
gccgagccgagcgtccgaggtgctgcagggcgtggcctcctcggtgcagggggaggtggaggagaagctgcggccgtggc
tggacacggtctccgtggtgtcggtggacgccgcccggacggtgttccagcaggtgatggagaaggagtttgaagacggc
gtggttaactgggggaggatcgtgaccgtattcgcgttcgagggcgtcctcctcaagaagctgctgcgggagcgagcggc
cccggacgtggacgcgcggacggtctcccacttcgtcgccgagttcgtcgtgaggcacacaggggagtggatccggcaga
acggaggctgggtgattgcccacagtcaatatcagaagtctaacaggatttccatctttctgagcatgcaagacgaagtc
gagaccgaagagatcatcagggacatcttccggcaagggaaggcctgcttcnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntcacttccc
acggtttcagtgatgtcacttcccacgatttcagtgacatcatcgcttcccgcgatttcagtgacgtcatcacttcccat
ggtttcagtgatatcatcacttcccacgatttcagtgatgtattcacttcccatgatttcagtgatgtcatcacttccca
gggtttcagtgatgtcatcacttcccacgatttcagtgatgtcttcgcttcccacgatttcagtgatgtcatggcttccc
acggtttcagtgatgtcatcacttcccacggtttcagtgatgtcatcacttactttccacggtctcagtga
>gnl|bcl2dbcds|A0A673UC80_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Suricata suricatta GN=BCL2L10 (length=579 residues).
atggctgacccgttgagagagcgtactgcgcgattattaacggacttcctggagtactgcgctcgggcccccggcagccc
cgcgcgggcgccgtccacgcccgaggctgaagtgctgcgctacgtggccacccaagtacaacagagccaccagcaattct
tgtcgaatttccgcggctaccgccagaaccgcgttgcgctagtggggcggttggagcggtatttactccccgacccccaa
aacgtcagctggggctatatagcagcgctgttgatcttcgcggggacgctgctggagaggccgccaccagggaacgactt
gaccctgaagccggaccaggaacaggacctggagtgggagaccaacgttgaccaggactgccagcgcctggtggctttgc
tctgcgatcggcttatggaacggcatcgcgcctggctggaggcgcacaatggctgggatggcttttgtctcttcttctca
cccctgctgccatattcttggaaaacattgctggtccaggctcttctgtcatgcgttacagtaatgatcttaatctacct
cttgagaagattatcatga
>gnl|bcl2dbcds|A0A673UUI0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Suricata suricatta GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggtcgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagcgatgtggaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccgtcaatggca
acccatcctggcacttggcagacagccctgcggtgaatggagccactggccacagcagcagcttggacgcccgggaggtg
atccccatggcagcggtgaagcaggcgctgagggaggccggggatgagtttgaactgaggtaccggcgggcattcagcga
cctgacatcccagcttcacatcaccccagggacagcgtatcagagtttcgagcaggtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacgtggatggccacttacctgaacgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A673VAY7_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Suricata suricatta GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcagccccagacacacgggctctagtggcagactttgtaggctataagctgaggcagaagggtta
tgtttgtggagcaggccctggggagggcccagcagctgacccactgcatcaagccatgcgggcagctggagatgagtttg
agacccgcttccggcgcaccttctctgatttggcagcccagttgcatgtgacccctggctcagcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcgctatg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaagagtggatggtggcctacctggagacacggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcctcagtgaggacagtgctgacaggggccgtggcactgggggccctggtaactgtagg
agccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A673VDM8_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Suricata suricatta GN=BCL-2 (length=720 residues).
atggcgcacgccgggagaacagggtacgataaccgggagatcgtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggacgccggagacgcgggcgccgcgcccccgggggtcgcccccgcgccgggcatctcctcctcccagcccg
ggcgcacccccctccccgccgcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngccgcccccgccgcc
gccgcgggccccgcgctcagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcg
ctaccgccgcgacttcgcggagatgtccagccagctgcacctgaccccgttcaccgcgaggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagtttggtggggtcatgtgtgtggag
agcgtcaaccgagagatgtcgcccctggtggacaacatcgccctatggatgactgagtacctgaaccggcacctgcacac
ctggatccaggacaacggaggctgggatgcctttgtggagctgtacggccctagcatgcagcctctgtttgatttctcct
ggctgtctctgaaggccctgctcagcctggccctggtgggggcgtgcgtcaccttgggtgcctatctgggccacaagtga
© 1998-2020Legal notice