Dataset for CDS BCL-2-like of organism Suricata suricatta

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A673TDC6_BCL2A1-      atggcggacggcgagttcgggttcgtcctcacgctggcccaggactacat
A0A673UUI0_BCL2L1-      atgtct----------------------------------cagagcaacc
A0A673UC80_BCL2L10      atggctgacccgttgag-------------------agagcgtactgcgc
A0A673VDM8_BCL2-01      atggcgcacgccgggagaa----------------cagggtacgataacc
A0A673VAY7_BCL2L2-      atg-gcgacccca------------------gcctcagccccagacacac
A0A673TBH1_MCL1-04      atgtttggcctcaagaggaacgccgtaatcggactcaacctctactgtgg
A0A673TBH1_MCL1-05      atgtttggcctcaagaggaacgccgtaatcggactcaacctctactgtgg
A0A673TBH1_MCL1-03      atgtttggcctcaagaggaacgccgtaatcggactcaacctctactgtgg
A0A673TBH1_MCL1-01      atgtttggcctcaagaggaacgccgtaatcggactcaacctctactgtgg
A0A673TBH1_MCL1-02      atgtttggcctcaagaggaacgccgtaatcggactcaacctctactgtgg
                        ***                                               

A0A673TDC6_BCL2A1-      ggggcacgtcctgca-------ggtgccgccgccg---------------
A0A673UUI0_BCL2L1-      gggagct---------------ggtggtcgacttt------------ctc
A0A673UC80_BCL2L10      gatt------------------attaacggacttc---------------
A0A673VDM8_BCL2-01      gggagat---------------cgtgatgaagtac------------atc
A0A673VAY7_BCL2L2-      gggctct---------------agtggcagacttt------------gta
A0A673TBH1_MCL1-04      gggggccgggttgggggccgggagtggcggcgcctcctcttcgggagggg
A0A673TBH1_MCL1-05      gggggccgggttgggggccgggagtggcggcgcctcctcttcgggagggg
A0A673TBH1_MCL1-03      gggggccgggttgggggccgggagtggcggcgcctcctcttcgggagggg
A0A673TBH1_MCL1-01      gggggccgggttgggggccgggagtggcggcgcctcctcttcgggagggg
A0A673TBH1_MCL1-02      gggggccgggttgggggccgggagtggcggcgcctcctcttcgggagggg
                        *                       *                         

A0A673TDC6_BCL2A1-      ------cagccgagccgagcgt----------------------------
A0A673UUI0_BCL2L1-      tcctacaagctttcc-----------------------------------
A0A673UC80_BCL2L10      --------------------------------------------------
A0A673VDM8_BCL2-01      cactataagctgtcg-----------------------------------
A0A673VAY7_BCL2L2-      ggctataagctgagg-----------------------------------
A0A673TBH1_MCL1-04      ggcttttagccgtagggaaggaggccacggcccggcgggaggtaggggga
A0A673TBH1_MCL1-05      ggctttta------------------------------------------
A0A673TBH1_MCL1-03      ggcttttagccgtagggaaggaggccacggcccggcgggaggtaggggga
A0A673TBH1_MCL1-01      ggcttttagccgtagggaaggaggccacggcccggcgggaggtaggggga
A0A673TBH1_MCL1-02      ggcttttagccgtagggaaggaggccacggcccggcgggaggtaggggga
                                                                          

A0A673TDC6_BCL2A1-      --------------------------------------------------
A0A673UUI0_BCL2L1-      --------------------------------------------------
A0A673UC80_BCL2L10      --------------------------------------------------
A0A673VDM8_BCL2-01      --------------------------------------------------
A0A673VAY7_BCL2L2-      --------------------------------------------------
A0A673TBH1_MCL1-04      ggggaagccggtgcggtgattggcggaagcgccggcgcgagccccccggc
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      ggggaagccggtgcggtgattggcggaagcgccggcgcgagccccccggc
A0A673TBH1_MCL1-01      ggggaagccggtgcggtgattggcggaagcgccggcgcgagccccccggc
A0A673TBH1_MCL1-02      ggggaagccggtgcggtgattggcggaagcgccggcgcgagccccccggc
                                                                          

A0A673TDC6_BCL2A1-      ------------------ccgaggtgctgcagggcgtggcctcctcggtg
A0A673UUI0_BCL2L1-      ------------------cagaaaggataca-gctggagtcagtttagcg
A0A673UC80_BCL2L10      ------------------ctggagtactgcg-------------------
A0A673VDM8_BCL2-01      ------------------cagaggggctacgag----tgggacgccggag
A0A673VAY7_BCL2L2-      ------------------cagaagggttatg-------------tttgtg
A0A673TBH1_MCL1-04      cacttttgcgcccgacgcccggagggtcgcgcggccctcgcccattggcg
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      cacttttgcgcccgacgcccggagggtcgcgcggccctcgcccattggcg
A0A673TBH1_MCL1-01      cacttttgcgcccgacgcccggagggtcgcgcggccctcgcccattggcg
A0A673TBH1_MCL1-02      cacttttgcgcccgacgcccggagggtcgcgcggccctcgcccattggcg
                                                                          

A0A673TDC6_BCL2A1-      cagggg---------gaggtgg----------------------------
A0A673UUI0_BCL2L1-      atgtggaagagaacagaactgaggccccagaagg----------------
A0A673UC80_BCL2L10      -ctcgg---------gcccc------------------------------
A0A673VDM8_BCL2-01      acgcgg---------gcgccgcgcccccggg-------------------
A0A673VAY7_BCL2L2-      gagcag---------gccctgg----------------------------
A0A673TBH1_MCL1-04      ccgagg---------gccccgacgtcacggctacctccccgaagctgctg
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      ccgagg---------gccccgacgtcacggctacctccccgaagctgctg
A0A673TBH1_MCL1-01      ccgagg---------gccccgacgtcacggctacctccccgaagctgctg
A0A673TBH1_MCL1-02      ccgagg---------gccccgacgtcacggctacctccccgaagctgctg
                                                                          

A0A673TDC6_BCL2A1-      -----------------------------------------aggagaagc
A0A673UUI0_BCL2L1-      -----------------------------------------gactgaatc
A0A673UC80_BCL2L10      -----------------------------------------cggcagccc
A0A673VDM8_BCL2-01      -----------------------------------------ggtcgcccc
A0A673VAY7_BCL2L2-      -----------------------------------------ggagggccc
A0A673TBH1_MCL1-04      ttctatgcggccacccgctgtgcgtcgccgcctgaagagatggaaggccc
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      ttctatgcggccacccgctgtgcgtcgccgcctgaagagatggaaggccc
A0A673TBH1_MCL1-01      ttctatgcggccacccgctgtgcgtcgccgcctgaagagatggaaggccc
A0A673TBH1_MCL1-02      ttctatgcggccacccgctgtgcgtcgccgcctgaagagatggaaggccc
                                                                          

A0A673TDC6_BCL2A1-      tgcggccgtggctggacacggtctccgtggtgtcggtggac---------
A0A673UUI0_BCL2L1-      agagatggagacc-cccagtgccgtcaatggcaacccatcctggca----
A0A673UC80_BCL2L10      cgcg-cgggcgccgtccacgcccgaggctgaagtgctgcgc---------
A0A673VDM8_BCL2-01      cgcgccgggcatc-tcctcctc----------------------------
A0A673VAY7_BCL2L2-      agcagctgac-cc-actgcatc----------aagccatgcgggca----
A0A673TBH1_MCL1-04      cgcggccgacgcc-atcatgtcgcccgaagaggagctggacgggtacgag
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      cgcggccgacgcc-atcatgtcgcccgaagaggagctggacgggtacgag
A0A673TBH1_MCL1-01      cgcggccgacgcc-atcatgtcgcccgaagaggagctggacgggtacgag
A0A673TBH1_MCL1-02      cgcggccgacgcc-atcatgtcgcccgaagaggagctggacgggtacgag
                                                                          

A0A673TDC6_BCL2A1-      --------------------------------------------------
A0A673UUI0_BCL2L1-      --------------------------------------------------
A0A673UC80_BCL2L10      --------------------------------------------------
A0A673VDM8_BCL2-01      --------------------------------------------------
A0A673VAY7_BCL2L2-      --------------------------------------gctggagatga-
A0A673TBH1_MCL1-04      ccggaacccttggggaagcggccggccgtcctgcctttgctggagctggt
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      ccggaacccttggggaagcggccggccgtcctgcctttgctggagctggt
A0A673TBH1_MCL1-01      ccggaacccttggggaagcggccggccgtcctgcctttgctggagctggt
A0A673TBH1_MCL1-02      ccggaacccttggggaagcggccggccgtcctgcctttgctggagctggt
                                                                          

A0A673TDC6_BCL2A1-      --------------------gccgcccggacggt---------gttccag
A0A673UUI0_BCL2L1-      --------------------cttggcagacagccctgcg-----------
A0A673UC80_BCL2L10      --------tacgtggccacccaagtacaacagagccaccagcaattcttg
A0A673VDM8_BCL2-01      --------------------ccagcccgggcgcaccccc----ctccccg
A0A673VAY7_BCL2L2-      --------------------------------------------------
A0A673TBH1_MCL1-04      cggggaggccagcggtggccccggcacggacggctcact----gccctcg
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      cggggaggccagcggtggccccggcacggacggctcact----gccctcg
A0A673TBH1_MCL1-01      cggggaggccagcggtggccccggcacggacggctcact----gccctcg
A0A673TBH1_MCL1-02      cggggaggccagcggtggccccggcacggacggctcact----gccctcg
                                                                          

A0A673TDC6_BCL2A1-      caggtgatggagaaggagtttgaagacggcgtggttaactgggggaggat
A0A673UUI0_BCL2L1-      --------------------------------------------------
A0A673UC80_BCL2L10      tcga----------------------------------------------
A0A673VDM8_BCL2-01      ccgcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngcc
A0A673VAY7_BCL2L2-      -----------------------------------------------gtt
A0A673TBH1_MCL1-04      acgccacccccggtggaggaggaggaggacgagttgttccggcagtcgtt
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      acgccacccccggtggaggaggaggaggacgagttgttccggcagtcgtt
A0A673TBH1_MCL1-01      acgccacccccggtggaggaggaggaggacgagttgttccggcagtcgtt
A0A673TBH1_MCL1-02      acgccacccccggtggaggaggaggaggacgagttgttccggcagtcgtt
                                                                          

A0A673TDC6_BCL2A1-      cgtgaccgtattc------------------gcgttcgagggcgtcctcc
A0A673UUI0_BCL2L1-      -------------------------------gtgaatggagccactggcc
A0A673UC80_BCL2L10      -------------------------------atttccgcggctaccg---
A0A673VDM8_BCL2-01      -------------------------------gcccccgccgccgccg---
A0A673VAY7_BCL2L2-      tgagaccc-----------------------gcttccggcgc--------
A0A673TBH1_MCL1-04      agagattatctctcggtaccttcgggagcaggcgaccggcgccaagg---
A0A673TBH1_MCL1-05      -------------------------------gcgaccggcgccaagg---
A0A673TBH1_MCL1-03      agagattatctctcggtaccttcgggagcaggcgaccggcgccaagg---
A0A673TBH1_MCL1-01      agagattatctctcggtaccttcgggagcaggcgaccggcgccaagg---
A0A673TBH1_MCL1-02      agagattatctctcggtaccttcgggagcaggcgaccggcgccaagg---
                                                             *  *         

A0A673TDC6_BCL2A1-      tcaagaagctgctgcgggagcgagcggccccggacgtggacgcgcggacg
A0A673UUI0_BCL2L1-      acagcagcagcttggacg----------cccgggag--------------
A0A673UC80_BCL2L10      ccagaaccgcgttgcgct-------agt--ggggcg--------------
A0A673VDM8_BCL2-01      ----------------cg-------ggccccg--cg--------------
A0A673VAY7_BCL2L2-      ------accttct---ct-------gatttgg------------------
A0A673TBH1_MCL1-04      acgggaagccactgggcg-------ggtccggggcg--------------
A0A673TBH1_MCL1-05      acgggaagccactgggcg-------ggtccggggcg--------------
A0A673TBH1_MCL1-03      acgggaagccactgggcg-------ggtccggggcg--------------
A0A673TBH1_MCL1-01      acgggaagccactgggcg-------ggtccggggcg--------------
A0A673TBH1_MCL1-02      acgggaagccactgggcg-------ggtccggggcg--------------
                                                       *                  

A0A673TDC6_BCL2A1-      gtctcccacttcgtcgccgagttcgtcgtgaggcacaca--ggggagtgg
A0A673UUI0_BCL2L1-      --------------------gtgatccccatggcagcgg---tgaagcag
A0A673UC80_BCL2L10      --------------------gttgg---agcggtattta----ctccccg
A0A673VDM8_BCL2-01      --------------------ctcagccccgtgccacctgtggtccacctg
A0A673VAY7_BCL2L2-      ----------------------cagcccagttgcat--g---------tg
A0A673TBH1_MCL1-04      --------------------gccagccgaaaggcgttag---------ag
A0A673TBH1_MCL1-05      --------------------gccagccgaaaggcgttag---------ag
A0A673TBH1_MCL1-03      --------------------gccagccgaaaggcgttag---------ag
A0A673TBH1_MCL1-01      --------------------gccagccgaaaggcgttag---------ag
A0A673TBH1_MCL1-02      --------------------gccagccgaaaggcgttag---------ag
                                                                         *

A0A673TDC6_BCL2A1-      atccggcagaacggaggctgg----gtgattgcccacagtcaatatcaga
A0A673UUI0_BCL2L1-      gcgct----gagggaggccggggatgagtttgaactgaggtaccggcggg
A0A673UC80_BCL2L10      acccccaaaacgtcagctggg----gctatatagcagcgctgttg----a
A0A673VDM8_BCL2-01      accct----gcgccaggccggcgatgacttctcccgtcgctaccgccgcg
A0A673VAY7_BCL2L2-      accc--------ctggctcag-----------------------------
A0A673TBH1_MCL1-04      accct----gcgccgggtcggcgacggcgtacagcgaaaccacgagacgg
A0A673TBH1_MCL1-05      accct----gcgccgggtcggcgacggcgtacagcgaaaccacgagacgg
A0A673TBH1_MCL1-03      accct----gcgccgggtcggcgacggcgtacagcgaaaccacgagacgg
A0A673TBH1_MCL1-01      accct----gcgccgggtcggcgacggcgtacagcgaaaccacgagacgg
A0A673TBH1_MCL1-02      accct----gcgccgggtcggcgacggcgtacagcgaaaccacgagacgg
                           *           *    *                             

A0A673TDC6_BCL2A1-      agtctaacaggatttccatctttctgagcatgcaagacgaagtcgagacc
A0A673UUI0_BCL2L1-      cattcagcgacctgacatcccagcttcacatcaccccagggacagcgtat
A0A673UC80_BCL2L10      tcttcgcggggacgctgctggag-------------aggccgccaccagg
A0A673VDM8_BCL2-01      acttcgcggagatgtccagccagctgcacctgaccccgttcaccgcgagg
A0A673VAY7_BCL2L2-      ----cccagcaacgcttc--------------------------------
A0A673TBH1_MCL1-04      ccttccaaggcatgcttcggaaactggacatcaaaaacgaagacgatgtc
A0A673TBH1_MCL1-05      ccttccaaggcatgcttcggaaactggacatcaaaaacgaagacgatgtc
A0A673TBH1_MCL1-03      ccttccaaggcatgcttcggaaactggacatcaaaaacgaagacgatgtc
A0A673TBH1_MCL1-01      ccttccaaggcatgcttcggaaactggacatcaaaaacgaagacgatgtc
A0A673TBH1_MCL1-02      ccttccaaggcatgcttcggaaactggacatcaaaaacgaagacgatgtc
                                                                          

A0A673TDC6_BCL2A1-      gaaga----------gatcatcagggacatcttccggcaagggaaggcct
A0A673UUI0_BCL2L1-      cagag-tttcgagcaggtagtgaatgaactcttccgggatggggt---ga
A0A673UC80_BCL2L10      gaacgacttgaccctgaagccgga--------ccaggaacagg------a
A0A673VDM8_BCL2-01      ggacg-ctttgccacggtggtggaggagctcttcagggacggggt---ga
A0A673VAY7_BCL2L2-      --acc-caggtctctgatga------actcttccaa----gggggcccca
A0A673TBH1_MCL1-04      aaatc-tttgtctcgagtgatggtccacgttttcagtgacggagtaacaa
A0A673TBH1_MCL1-05      aaatc-tttgtctcgagtgatggtccacgttttcagtgacggagtaacaa
A0A673TBH1_MCL1-03      aaatc-tttgtctcgagtgatggtccacgttttcagtgacggagtaacaa
A0A673TBH1_MCL1-01      aaatc-tttgtctcgagtgatggtccacgttttcagtgacggagtaacaa
A0A673TBH1_MCL1-02      aaatc-tttgtctcgagtgatggtccacgttttcagtgacggagtaacaa
                                                         *       *        

A0A673TDC6_BCL2A1-      gcttcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
A0A673UUI0_BCL2L1-      act-----------------------------------------------
A0A673UC80_BCL2L10      cct-----------------------------------------------
A0A673VDM8_BCL2-01      act-----------------------------------------------
A0A673VAY7_BCL2L2-      act-----------------------------------------------
A0A673TBH1_MCL1-04      act-----------------------------------------------
A0A673TBH1_MCL1-05      act-----------------------------------------------
A0A673TBH1_MCL1-03      act-----------------------------------------------
A0A673TBH1_MCL1-01      act-----------------------------------------------
A0A673TBH1_MCL1-02      act-----------------------------------------------
                         **                                               

A0A673TDC6_BCL2A1-      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
A0A673UUI0_BCL2L1-      --------------------------------------------------
A0A673UC80_BCL2L10      --------------------------------------------------
A0A673VDM8_BCL2-01      --------------------------------------------------
A0A673VAY7_BCL2L2-      --------------------------------------------------
A0A673TBH1_MCL1-04      --------------------------------------------------
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      --------------------------------------------------
A0A673TBH1_MCL1-01      --------------------------------------------------
A0A673TBH1_MCL1-02      --------------------------------------------------
                                                                          

A0A673TDC6_BCL2A1-      nnnnntcacttcccacggtttcagtgatgtcacttcccacgatttcagtg
A0A673UUI0_BCL2L1-      -----------------ggggtcgcattgtggcctttttctccttcggtg
A0A673UC80_BCL2L10      -----------------ggagtggga----gacc----------------
A0A673VDM8_BCL2-01      -----------------gggggaggattgtggccttctttgagtttggtg
A0A673VAY7_BCL2L2-      -----------------ggggccgccttgtggccttctttgtctttggag
A0A673TBH1_MCL1-04      -----------------ggggcaggattgtgactctcatttcttttggtg
A0A673TBH1_MCL1-05      -----------------ggggcaggattgtgactctcatttcttttggtg
A0A673TBH1_MCL1-03      -----------------ggggcaggattgtgactctcatttcttttggtg
A0A673TBH1_MCL1-01      -----------------ggggcaggattgtgactctcatttcttttggtg
A0A673TBH1_MCL1-02      -----------------ggggcaggattgtgactctcatttcttttggtg
                                         *     *        *                 

A0A673TDC6_BCL2A1-      acatcatcgcttcccgcgatttcagtgacg--------------tcatca
A0A673UUI0_BCL2L1-      ------gggcactgtgcgtggaaagcgtagacaaggag------atgcag
A0A673UC80_BCL2L10      -----------------------aacgttgaccaggac------tgccag
A0A673VDM8_BCL2-01      ------gggtcatgtgtgtggagagcgtcaaccgagag------atgtcg
A0A673VAY7_BCL2L2-      cc------gcgctatgtgctgagagtgtcaacaaggag------atggag
A0A673TBH1_MCL1-04      cctttgtggccaaacatttgaagagtataaaccaagaaagctgcatcgaa
A0A673TBH1_MCL1-05      cctttgtggccaaacatttgaagagtataaaccaagaaagctgcatcgaa
A0A673TBH1_MCL1-03      cctttgtggccaaacatttgaagagtataaaccaagaaagctgcatcgaa
A0A673TBH1_MCL1-01      cctttgtggccaaacatttgaagagtataaaccaagaaagctgcatcgaa
A0A673TBH1_MCL1-02      cctttgtggccaaacatttgaagagtataaaccaagaaagctgcatcgaa
                                               *                          

A0A673TDC6_BCL2A1-      cttcccatggtttcagtgatatcatcacttcccacg-atttcagtgatgt
A0A673UUI0_BCL2L1-      gtattggtgagtcggatcgcaacgtggatggccacttacct--gaacgac
A0A673UC80_BCL2L10      cgcctggtggctttgctctgcgatcggcttat-----------ggaacgg
A0A673VDM8_BCL2-01      cccctggtggacaacatcgccctatggatgactgagtacct--gaaccgg
A0A673VAY7_BCL2L2-      ccacttgtgggacaagtgcaagagtggatggtggcctacctg-gagacac
A0A673TBH1_MCL1-04      ccattagcaga--aagcatcaca---gatgttctcgtaaggacgaaacga
A0A673TBH1_MCL1-05      ccattagcaga--aagcatcaca---gatgttctcgtaaggacgaaacga
A0A673TBH1_MCL1-03      ccattagcaga--aagcatcaca---gatgttctcgtaaggacgaaacga
A0A673TBH1_MCL1-01      ccattagcaga--aagcatcaca---gatgttctcgtaaggacgaaacga
A0A673TBH1_MCL1-02      ccattagcaga--aagcatcaca---gatgttctcgtaaggacgaaacga
                                                    *              *      

A0A673TDC6_BCL2A1-      attcacttcccatgatttcagtgatgtcatcacttcccagggtttcagtg
A0A673UUI0_BCL2L1-      cacctagagccttggatccaggagaacggcggct-----ggg--------
A0A673UC80_BCL2L10      catcg---cgcctggctggaggcgcacaatggct-----ggg--------
A0A673VDM8_BCL2-01      cacctgcacacctggatccaggacaacggaggct-----ggg--------
A0A673VAY7_BCL2L2-      ggctggc-tgactggatccacagcagtgggggct-----ggg--------
A0A673TBH1_MCL1-04      gactggc-tagtcaaacaaa--------gaggct-----ggg--------
A0A673TBH1_MCL1-05      gactggc-tagtcaaacaaa--------gaggct-----ggg--------
A0A673TBH1_MCL1-03      gactggc-tagtcaaacaaa--------gaggct-----ggg--------
A0A673TBH1_MCL1-01      gactggc-tagtcaaacaaa--------gaggct-----g----------
A0A673TBH1_MCL1-02      gactggc-tagtcaaacaaa--------gaggct-----g----------
                                           *            **     *          

A0A673TDC6_BCL2A1-      atgtcatcacttcccacgatttcagtgatgtcttcgcttcccacgatttc
A0A673UUI0_BCL2L1-      ---------------acacttttgtggaactctacgggaacaatgcagca
A0A673UC80_BCL2L10      ---------------atggcttttgtctcttcttc---------------
A0A673VDM8_BCL2-01      ---------------atgcctttgtggagctgtac--------ggcccta
A0A673VAY7_BCL2L2-      ---------------cggagttcacagctctatacggggacggggccctg
A0A673TBH1_MCL1-04      ---------------atgggtttgtggagttcttccatgtagaggaccta
A0A673TBH1_MCL1-05      ---------------atgggtttgtggagttcttccatgtagaggaccta
A0A673TBH1_MCL1-03      ---------------atgggtttgtggagttcttccatgtagaggaccta
A0A673TBH1_MCL1-01      --------------------------------------------------
A0A673TBH1_MCL1-02      --------------------------------------------------
                                                                          

A0A673TDC6_BCL2A1-      agtg-------------atgtcatggcttcccacggtttcagtgatgtca
A0A673UUI0_BCL2L1-      gccgaga----------gccggaagggccaggagcgcttcaa-----ccg
A0A673UC80_BCL2L10      ---------tcacccctgctgccatattcttggaaaacattgctggtcca
A0A673VDM8_BCL2-01      gcat----gcagcctctgtttgatttctcctggctgtctctgaaggccct
A0A673VAY7_BCL2L2-      gaggaggcgcggcgtctgcgggaggggaactgg--gcctcagtgaggaca
A0A673TBH1_MCL1-04      gaag-------------gtggcatcagaaatgt--gctgctg--------
A0A673TBH1_MCL1-05      gaag-------------gtggcatcagaaatgt--gctgctg--------
A0A673TBH1_MCL1-03      gaag-------------gtggcatcagaaatgt--gctgctg--------
A0A673TBH1_MCL1-01      --------------------------------------------------
A0A673TBH1_MCL1-02      --------------------------------------------------
                                                                          

A0A673TDC6_BCL2A1-      tcacttcccac----ggtttcagtgatgtcatcacttactttccacggt-
A0A673UUI0_BCL2L1-      ctggttcctgacaggcatgactgtggctggcgtggt-----tctgctggg
A0A673UC80_BCL2L10      ggctcttctgtcatgcgttacagtaatgatcttaatctacctcttgagaa
A0A673VDM8_BCL2-01      gctcagcctggccc-tgg-----tgggggcgtgcgt----caccttgggt
A0A673VAY7_BCL2L2-      gtgctgacaggggc-cgtggcactgggggccctggt----aactgtagga
A0A673TBH1_MCL1-04      gcttttgcaggt----------------------gt----tgctggagta
A0A673TBH1_MCL1-05      gcttttgcaggt----------------------gt----tgctggagta
A0A673TBH1_MCL1-03      gcttttgcaggcac-agggacccctggaagtctggc----ttctggaagt
A0A673TBH1_MCL1-01      ---------ggcac-agggacccctggaagtctggc----ttctggaagt
A0A673TBH1_MCL1-02      ---------ggcac-agggacccctggaagtctggc----ttctggaagt
                                                                  *       

A0A673TDC6_BCL2A1-      ----------------------------------ctcagtga--------
A0A673UUI0_BCL2L1-      ctcgctcttcagtc--------------------ggaaatga--------
A0A673UC80_BCL2L10      gattatc-------------------------------atga--------
A0A673VDM8_BCL2-01      gcctatctgggcc---------------------acaagtga--------
A0A673VAY7_BCL2L2-      g----ccttttttgcta-----------------gcaagtga--------
A0A673TBH1_MCL1-04      ggag--ctggtttggcatatctaa----------taagatag--------
A0A673TBH1_MCL1-05      ggag--ctggtttggcatatctaa----------taagatag--------
A0A673TBH1_MCL1-03      ggagacctggactcagacctcagaattgccggggtcagataa--------
A0A673TBH1_MCL1-01      ggagacctggactcagacctcagaattgccggggtcagataaaggggtcc
A0A673TBH1_MCL1-02      ggagacctggactcagacctcagaattgccggggtcagataaagg-----
                                                               *          

A0A673TDC6_BCL2A1-      --------------------------------------------------
A0A673UUI0_BCL2L1-      --------------------------------------------------
A0A673UC80_BCL2L10      --------------------------------------------------
A0A673VDM8_BCL2-01      --------------------------------------------------
A0A673VAY7_BCL2L2-      --------------------------------------------------
A0A673TBH1_MCL1-04      --------------------------------------------------
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      --------------------------------------------------
A0A673TBH1_MCL1-01      caggctgcaggctcgcatgtcaggggggcggcctcccggcgcacaggtct
A0A673TBH1_MCL1-02      --------------------------------------------------
                                                                          

A0A673TDC6_BCL2A1-      --------------------------------------------------
A0A673UUI0_BCL2L1-      --------------------------------------------------
A0A673UC80_BCL2L10      --------------------------------------------------
A0A673VDM8_BCL2-01      --------------------------------------------------
A0A673VAY7_BCL2L2-      --------------------------------------------------
A0A673TBH1_MCL1-04      --------------------------------------------------
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      --------------------------------------------------
A0A673TBH1_MCL1-01      gctcacttgtacctactctggcttcctcctggctcaacccatgggcctcc
A0A673TBH1_MCL1-02      --------------------------------------------------
                                                                          

A0A673TDC6_BCL2A1-      --------------------------------------------------
A0A673UUI0_BCL2L1-      --------------------------------------------------
A0A673UC80_BCL2L10      --------------------------------------------------
A0A673VDM8_BCL2-01      --------------------------------------------------
A0A673VAY7_BCL2L2-      --------------------------------------------------
A0A673TBH1_MCL1-04      --------------------------------------------------
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      --------------------------------------------------
A0A673TBH1_MCL1-01      ccactcccaaggcagactacggaccgtcgctggattcctgtcccacactc
A0A673TBH1_MCL1-02      --------------------------------------------------
                                                                          

A0A673TDC6_BCL2A1-      --------------------------------------------------
A0A673UUI0_BCL2L1-      --------------------------------------------------
A0A673UC80_BCL2L10      --------------------------------------------------
A0A673VDM8_BCL2-01      --------------------------------------------------
A0A673VAY7_BCL2L2-      --------------------------------------------------
A0A673TBH1_MCL1-04      --------------------------------------------------
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      --------------------------------------------------
A0A673TBH1_MCL1-01      agcagagcactgttgaggaagtgatggcgaactcgccgactcctctggcc
A0A673TBH1_MCL1-02      --------------------------------------------------
                                                                          

A0A673TDC6_BCL2A1-      --------------------------------------------------
A0A673UUI0_BCL2L1-      --------------------------------------------------
A0A673UC80_BCL2L10      --------------------------------------------------
A0A673VDM8_BCL2-01      --------------------------------------------------
A0A673VAY7_BCL2L2-      --------------------------------------------------
A0A673TBH1_MCL1-04      --------------------------------------------------
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      --------------------------------------------------
A0A673TBH1_MCL1-01      gcgcccacaccgcacggagcactgagggtaggagagcctcccagagcctg
A0A673TBH1_MCL1-02      --------------------------------------------------
                                                                          

A0A673TDC6_BCL2A1-      --------------------------------------------------
A0A673UUI0_BCL2L1-      --------------------------------------------------
A0A673UC80_BCL2L10      --------------------------------------------------
A0A673VDM8_BCL2-01      --------------------------------------------------
A0A673VAY7_BCL2L2-      --------------------------------------------------
A0A673TBH1_MCL1-04      --------------------------------------------------
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      --------------------------------------------------
A0A673TBH1_MCL1-01      gattcgcaggcatcctcccgctcctccagttccagggcctttgacccagg
A0A673TBH1_MCL1-02      --------------------------------------------------
                                                                          

A0A673TDC6_BCL2A1-      --------------------------------------------------
A0A673UUI0_BCL2L1-      --------------------------------------------------
A0A673UC80_BCL2L10      --------------------------------------------------
A0A673VDM8_BCL2-01      --------------------------------------------------
A0A673VAY7_BCL2L2-      --------------------------------------------------
A0A673TBH1_MCL1-04      --------------------------------------------------
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      --------------------------------------------------
A0A673TBH1_MCL1-01      acctgcctcagtccctgcctggccaattacgtgactctgtgtgctggagg
A0A673TBH1_MCL1-02      --------------------------------------------------
                                                                          

A0A673TDC6_BCL2A1-      --------------------------------------------------
A0A673UUI0_BCL2L1-      --------------------------------------------------
A0A673UC80_BCL2L10      --------------------------------------------------
A0A673VDM8_BCL2-01      --------------------------------------------------
A0A673VAY7_BCL2L2-      --------------------------------------------------
A0A673TBH1_MCL1-04      --------------------------------------------------
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      --------------------------------------------------
A0A673TBH1_MCL1-01      gcaggctgggcatgtggctctgggccccaacccctggctcagtgtcttat
A0A673TBH1_MCL1-02      ----------------------------------------------ttcc
                                                                          

A0A673TDC6_BCL2A1-      --------------------------------------------------
A0A673UUI0_BCL2L1-      --------------------------------------------------
A0A673UC80_BCL2L10      --------------------------------------------------
A0A673VDM8_BCL2-01      --------------------------------------------------
A0A673VAY7_BCL2L2-      --------------------------------------------------
A0A673TBH1_MCL1-04      --------------------------------------------------
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      --------------------------------------------------
A0A673TBH1_MCL1-01      ctgctttatggatgggggctgcacaagagatctcattcatgaaaaagctt
A0A673TBH1_MCL1-02      ctgctttag-----------------------------------------
                                                                          

A0A673TDC6_BCL2A1-      -----------
A0A673UUI0_BCL2L1-      -----------
A0A673UC80_BCL2L10      -----------
A0A673VDM8_BCL2-01      -----------
A0A673VAY7_BCL2L2-      -----------
A0A673TBH1_MCL1-04      -----------
A0A673TBH1_MCL1-05      -----------
A0A673TBH1_MCL1-03      -----------
A0A673TBH1_MCL1-01      ctgctgattaa
A0A673TBH1_MCL1-02      -----------
                                   

© 1998-2020Legal notice