Dataset for CDS MCL-1 of organism Chrysemys picta bellii

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C3EZ48_MCL1-01      tgtgctggggggtgctcccccagttcacccagaccctgccccactccact
A0A8C3H9M3_MCL1-01      -atgttgg-------------cgttaaagcggaac--gcggtgatc----
                          ** ***              *** *  * ** *  **     **    

A0A8C3EZ48_MCL1-01      gcttccccccaggccccacctctgtcccactccatccccactccactgct
A0A8C3H9M3_MCL1-01      -----------ggcctcaac-ctgt---actgcgggggcggcccgacgct
                                   **** ** * ****   *** *     *   **   ***

A0A8C3EZ48_MCL1-01      gccctgcctcttcccgtcccgttctaccccatcccgagtgcaccctgccc
A0A8C3H9M3_MCL1-01      gcc---cccgtccccgccgggctc--------cccgagcg----gcgccg
                        ***   **  * **** *  * **        ****** *      *** 

A0A8C3EZ48_MCL1-01      tcactcctcccacccagtgcctcctacacactggatcatggcaggcagg-
A0A8C3H9M3_MCL1-01      ggacccctcccaccccgggccggctgctgagcgggccgcggggagcgggc
                          ** ********** * ***  ** *  *  **  *  **   ** ** 

A0A8C3EZ48_MCL1-01      -------------------------------------aggtcggcgatgg
A0A8C3H9M3_MCL1-01      cccgccgccctggagaaggcgctggagacgctgcggagggtcggcgacgg
                                                              ********* **

A0A8C3EZ48_MCL1-01      cgtcattgagaagcagcagatcaccttccaagggatgcttcggaagctag
A0A8C3H9M3_MCL1-01      cgtcatggagaagcaccagctcgccttccaagggatgcttcggaagctag
                        ****** ******** *** ** ***************************

A0A8C3EZ48_MCL1-01      acatcaagcatgaggaggatctgaagtcagtaactgctgttgcaacccat
A0A8C3H9M3_MCL1-01      acatcaagaatgaggaggatctgaagtcagtgactgccgttgcaacccat
                        ******** ********************** ***** ************

A0A8C3EZ48_MCL1-01      attttcaatgatggggtaacaaactggggtagaattgtgacactcatctc
A0A8C3H9M3_MCL1-01      gttttcagtgatggagtaacaaactggggtagaattgtgacactcatctc
                         ****** ****** ***********************************

A0A8C3EZ48_MCL1-01      ttttggtgcctttgttgcaaaacacctgaagagcataaaccaggagaatt
A0A8C3H9M3_MCL1-01      ttttggtgcctttgttgcaaaacacctgaagagcataaaccaggagaatt
                        **************************************************

A0A8C3EZ48_MCL1-01      gcatcaacacactagcagggatcatcacagatgtgcttgtcacaggcaaa
A0A8C3H9M3_MCL1-01      gcatcaacacactagcagggatcatcacagatgtgcttgtcacaggcaaa
                        **************************************************

A0A8C3EZ48_MCL1-01      cgacattggttagttaaccaaagaggctgggagggatttgttgaattctt
A0A8C3H9M3_MCL1-01      cgagattggctagttaaccaaagaggctgggagggatttgttgaattctt
                        *** ***** ****************************************

A0A8C3EZ48_MCL1-01      ccgtgtagaggatctagaaggtagcagcatcaggaatgttctggtggct-
A0A8C3H9M3_MCL1-01      ccgtgtagaggatctagaaggt---agcatcaggaatgttctggtggctt
                        **********************   ************************ 

A0A8C3EZ48_MCL1-01      --------tttgctggactgggagcatccttgttgagaggattttttttt
A0A8C3H9M3_MCL1-01      ttgcaggctttgctggactgggagcaagctt-------------------
                                ******************  ***                   

A0A8C3EZ48_MCL1-01      ttttttaaaagcagtggttataaatgttcaggcctgagtctccattgcat
A0A8C3H9M3_MCL1-01      ------------------------------ggcc-----------tacat
                                                      ****           * ***

A0A8C3EZ48_MCL1-01      aatgcagcagtga
A0A8C3H9M3_MCL1-01      gat---gcgatga
                         **   **  ***

© 1998-2022Legal notice