Dataset for CDS BCL2L1 of organism Dromaius novaehollandiae

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C4JDK2_BCL2L1-      atgtccagcagtaaccgggaattagtgattgactttgtttcctacaagct
A0A8C4JDK2_BCL2L1-      atgtccagcagtaaccgggaattagtgattgactttgtttcctacaagct
                        **************************************************

A0A8C4JDK2_BCL2L1-      ctcacagaaggactacagctggagtcagctcgaggaagaggatgagaaca
A0A8C4JDK2_BCL2L1-      ctcacagaaggactacagctggagtcagctcgaggaagaggatgagaaca
                        **************************************************

A0A8C4JDK2_BCL2L1-      ggactgattttgcggtagaggccgggatggccggtgtcctcaacgggagc
A0A8C4JDK2_BCL2L1-      ggactgattttgcggtagaggccgggatggccggtgtcctcaacgggagc
                        **************************************************

A0A8C4JDK2_BCL2L1-      ccgtcctggcacccccctgccagccacgtagtgaacggagccgccgtgca
A0A8C4JDK2_BCL2L1-      ccgtcctggcacccccctgccagccacgtagtgaacggagccgccgtgca
                        **************************************************

A0A8C4JDK2_BCL2L1-      caggagcagcctcgaggtccatgaaactgttcaagcagccgatgtgaggc
A0A8C4JDK2_BCL2L1-      caggagcagcctcgaggtccatgaaactgttcaagcagccgatgtgaggc
                        **************************************************

A0A8C4JDK2_BCL2L1-      aggcgctgagagaggcaggcgatgaatttgagctgaggtaccagagagct
A0A8C4JDK2_BCL2L1-      aggcgctgagagaggcaggcgatgaatttgagctgaggtaccagagagct
                        **************************************************

A0A8C4JDK2_BCL2L1-      ttcagtgacctcacttcccagctccacatcacccctgccacggcgtatca
A0A8C4JDK2_BCL2L1-      ttcagtgacctcacttcccagctccacatcacccctgccacggcgtatca
                        **************************************************

A0A8C4JDK2_BCL2L1-      gagcttcgagcaggtggtgaacgaactcttccgggatggagtgaactggg
A0A8C4JDK2_BCL2L1-      gagcttcgagcaggtggtgaacgaactcttccgggatggagtgaactggg
                        **************************************************

A0A8C4JDK2_BCL2L1-      gtcgcatcgtggctttcttctccttcggaggggcgttgtgtgtggagagc
A0A8C4JDK2_BCL2L1-      gtcgcatcgtggctttcttctccttcggaggggcgttgtgtgtggagagc
                        **************************************************

A0A8C4JDK2_BCL2L1-      gttgagaaggagatgcgggtattggttggacgcattgtatcttggatgac
A0A8C4JDK2_BCL2L1-      gttgagaaggagatgcgggtattggttggacgcattgtatcttggatgac
                        **************************************************

A0A8C4JDK2_BCL2L1-      cacgtacttgaccgaccatctagatccctggatccaagaaaatggcggat
A0A8C4JDK2_BCL2L1-      cacgtacttgaccgaccatctagatccctggatccaagaaaatggcggat
                        **************************************************

A0A8C4JDK2_BCL2L1-      gggagcggttcgtggacctctacgggaataatgctgctgctgagataagg
A0A8C4JDK2_BCL2L1-      g---gcgctgcatgggactctgc----------ccgtgggaggtatatgg
                        *   *** * * ***  **** *          * *  *  *  *** **

A0A8C4JDK2_BCL2L1-      aagggccaggagaccttcaacaaatggctcctgaccggggcgaccgtggc
A0A8C4JDK2_BCL2L1-      ----------------cctacagatgtct--------gagttttctt---
                                         * *** *** **        * *    * *   

A0A8C4JDK2_BCL2L1-      aggcgtgcttctgc--tgggatctctgctgagccgcaagtga
A0A8C4JDK2_BCL2L1-      ---cttgcttctgctttgggatc----------------tga
                           * *********  *******                ***

© 1998-2022Legal notice