Dataset for CDS BAX-like of Organism Gopherus agassizii

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A452GV90_BOK-01       atgg-----aggtgctacgccgttcc-----tcggtctttgctgcggagg
A0A452IG33_BAK1-01      atggcctctgggaacagcagcgacccaccagaccgtcatcgacgcagaac
                        ****      **  *  *  **  **      * *** * *  ** **  

A0A452GV90_BOK-01       tgatggaggtttttgatcggtctcccaccgacaaggagctggtgtcccag
A0A452IG33_BAK1-01      cagtgagaggctcaattcgg-------------aagatcaggtggcccag
                           **   *  *    ****             * ** * **** *****

A0A452GV90_BOK-01       gcta------aggtgctctgcaga---gactacatacattcccggctgct
A0A452IG33_BAK1-01      gagaccgaggaggtgttccggagctatgccttctaccgctaccagcagga
                        *  *      ***** ** * **    * ** *   *  * ** ** *  

A0A452GV90_BOK-01       tcggg------------------------------ctggcattggctgga
A0A452IG33_BAK1-01      gagggaagagggcggaggggaggtgccgatggaccccgagattgcagaga
                          ***                              * *  ****    **

A0A452GV90_BOK-01       gcaaaccagagcacagt-gcacccatgcct-----ggcggcagactggct
A0A452IG33_BAK1-01      tccagcaggagccgggcagcaccagtaaccaggtgggcaggcgcctggcc
                         * * *  ****   *  *****  *  *      *** *  * ***** 

A0A452GV90_BOK-01       -------gaggtgtc--cagcgtgc--------------ttctgcgacta
A0A452IG33_BAK1-01      atcatcggagatgacatcaacatgcggtatgacgcagagttccggaacat
                               *** ** *  ** * ***              *** *  **  

A0A452GV90_BOK-01       ggggacgagct------------agaatacatccgaccaaacatttaccg
A0A452IG33_BAK1-01      gctgaagaccctgcagcccacaaaggacaatgcctacgagtacttcacta
                        *  ** ** *             ** * *   ** ** *    ** **  

A0A452GV90_BOK-01       gaata---------ttgcccgccagctgaac----------------atc
A0A452IG33_BAK1-01      agatagcctccagcttgtttgacagcggcattaactggggcagggtgatt
                          ***         ***   * **** * *                 ** 

A0A452GV90_BOK-01       tcactgc----actccgagaccg--tggtgactgacgccttcttggcagt
A0A452IG33_BAK1-01      gcgctgctggggttcggttaccggatggcgattcatgt----------gt
                         * ****      ** *  ****  *** ** * * *           **

A0A452GV90_BOK-01       agcagcccagatcttcacagcaggtacagatgtctgtctgggctgtgttg
A0A452IG33_BAK1-01      accagcacgg-----------ggtgaccggcttcctccggagcattgctc
                        * **** * *            *  ** *   **   * * **  ** * 

A0A452GV90_BOK-01       gaaacaaactgaaatataaactctgctatt-tagcgttcagcttatt---
A0A452IG33_BAK1-01      gctacgtggcagaattcgtgctccgcaaccgcatcgcccagtggattgct
                        *  **       ***     *** ** *    * **  ***   ***   

A0A452GV90_BOK-01       -----aagaaaacagtc--caggtctgggactacagccctgctcaagtgc
A0A452IG33_BAK1-01      gaccaaggaggatgggtggcagcactggagttggat---------aatgt
                             * **  *  *    ***  ****   *  *          * ** 

A0A452GV90_BOK-01       ccactctctgtacct--------------------tcctgctgggcagtt
A0A452IG33_BAK1-01      ttacgtattgtacatgatgggggtgttggtcgtggtcctgctgggtcatt
                          **    ***** *                    **********   **

A0A452GV90_BOK-01       tttctctccttttaccccttctcctctcttactccattcttattccttcc
A0A452IG33_BAK1-01      tgg-----------------------tggtacgacg---------cttct
                        *                         *  ***  *          **** 

A0A452GV90_BOK-01       tcgacccctagtgcagcactga
A0A452IG33_BAK1-01      tcagccc-----------atga
                        **  ***            ***

© 1998-2023Legal notice