Dataset for CDS BAX of Organism Bos taurus

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A4W2H091_BAX-01      at----------gagaccccattctgattctgtatccccgcaac------
A0A4W2CIX3_BAX-02      atggacgggtccggggagcaacccagaggcggggggcccaccagctctga
A0A3Q1MN40_BAX-01      atggacgggtccggggagcaacccagaggcggggggcccaccagctctga
A0A4W2CIX3_BAX-01      atggacgggtccggggagcaacccagaggcggggggcccaccagctctga
A0A4W2H091_BAX-02      atggacgggtccggggagcaacccagaggcggggggcccaccagctctga
A0A3Q1MN40_BAX-02      atggacgggtccggggagcaacccagaggcggggggcccaccagctctga
A0A3Q1MN40_BAX-03      --------------------------------------------------
                                                                         

A0A4W2H091_BAX-01      --------------------tccgttcccaccctagtttcatccaggatc
A0A4W2CIX3_BAX-02      gcagatcatgaagacaggggcccttttgcttcagg---------------
A0A3Q1MN40_BAX-01      gcagatcatgaagacaggggcccttttgcttcagggtttcatccaggatc
A0A4W2CIX3_BAX-01      gcagatcatgaagacaggggcccttttgcttcagggtttcatccaggatc
A0A4W2H091_BAX-02      gcagatcatgaagacaggggcccttttgcttcagggtttcatccaggatc
A0A3Q1MN40_BAX-02      gcagatcatgaagacaggggcccttttgcttcagggtttcatccaggatc
A0A3Q1MN40_BAX-03      -------atgaagacaggggcccttttgcttcagggtttcatccaggatc
                                            ** **  *  *                  

A0A4W2H091_BAX-01      gagcagggcgaatggggggagagacacccgagctgggcttggagcaggtg
A0A4W2CIX3_BAX-02      --------------------------------------------------
A0A3Q1MN40_BAX-01      gagcagggcgaatggggggagagacacccgagctgggcttggagcaggtg
A0A4W2CIX3_BAX-01      gagcagggcgaatggggggagagacacccgagctgggcttggagcaggtg
A0A4W2H091_BAX-02      gagcagggcgaatggggggagagacacccgagctgggcttggagcaggtg
A0A3Q1MN40_BAX-02      gagcagggcgaatggggggagagacacccgagctgggcttggagcaggtg
A0A3Q1MN40_BAX-03      gagcagggcgaatggggggagagacacccgagctgggcttggagcaggtg
                                                                         

A0A4W2H091_BAX-01      ccccaggatgcatccaccaagaagctgagcgagtgtctgaagcgcatcgg
A0A4W2CIX3_BAX-02      --------------------------------------------------
A0A3Q1MN40_BAX-01      ccccaggatgcatccaccaagaagctgagcgagtgtctgaagcgcatcgg
A0A4W2CIX3_BAX-01      ccccaggatgcatccaccaagaagctgagcgagtgtctgaagcgcatcgg
A0A4W2H091_BAX-02      ccccaggatgcatccaccaagaagctgagcgagtgtctgaagcgcatcgg
A0A3Q1MN40_BAX-02      ccccaggatgcatccaccaagaagctgagcgagtgtctgaagcgcatcgg
A0A3Q1MN40_BAX-03      ccccaggatgcatccaccaagaagctgagcgagtgtctgaagcgcatcgg
                                                                         

A0A4W2H091_BAX-01      agatgaattggacagtaacatggagctgcagaggatgatcgcagctgtgg
A0A4W2CIX3_BAX-02      --------------------------------ggatgatcgcagctgtgg
A0A3Q1MN40_BAX-01      agatgaattggacagtaacatggagctgcagaggatgatcgcagctgtgg
A0A4W2CIX3_BAX-01      agatgaattggacagtaacatggagctgcagaggatgatcgcagctgtgg
A0A4W2H091_BAX-02      agatgaattggacagtaacatggagctgcagaggatgatcgcagctgtgg
A0A3Q1MN40_BAX-02      agatgaattggacagtaacatggagctgcagaggatgatcgcagctgtgg
A0A3Q1MN40_BAX-03      agatgaattggacagtaacatggagctgcagaggatgatcgcagctgtgg
                                                       ******************

A0A4W2H091_BAX-01      acacagactctccccgagaggtctttttccgagtggcggctgaaatgttt
A0A4W2CIX3_BAX-02      acacagactctccccgagaggtctttttccgagtggcggctgaaatgttt
A0A3Q1MN40_BAX-01      acacagactctccccgagaggtctttttccgagtggcggctgaaatgttt
A0A4W2CIX3_BAX-01      acacagactctccccgagaggtctttttccgagtggcggctgaaatgttt
A0A4W2H091_BAX-02      acacagactctccccgagaggtctttttccgagtggcggctgaaatgttt
A0A3Q1MN40_BAX-02      acacagactctccccgagaggtctttttccgagtggcggctgaaatgttt
A0A3Q1MN40_BAX-03      acacagactctccccgagaggtctttttccgagtggcggctgaaatgttt
                       **************************************************

A0A4W2H091_BAX-01      tctgacggcaacttcaactggggccgggttgtcgcccttttctactttgc
A0A4W2CIX3_BAX-02      tctgacggcaacttcaactggggccgggttgtcgcccttttctactttgc
A0A3Q1MN40_BAX-01      tctgacggcaacttcaactggggccgggttgtcgcccttttctactttgc
A0A4W2CIX3_BAX-01      tctgacggcaacttcaactggggccgggttgtcgcccttttctactttgc
A0A4W2H091_BAX-02      tctgacggcaacttcaactggggccgggttgtcgcccttttctactttgc
A0A3Q1MN40_BAX-02      tctgacggcaacttcaactggggccgggttgtcgcccttttctactttgc
A0A3Q1MN40_BAX-03      tctgacggcaacttcaactggggccgggttgtcgcccttttctactttgc
                       **************************************************

A0A4W2H091_BAX-01      cagcaaactggtgctcaaggccctgtgcaccaaggtgcccgagttgatca
A0A4W2CIX3_BAX-02      cagcaaactggtgctcaaggccctgtgcaccaaggtgcccgagttgatca
A0A3Q1MN40_BAX-01      cagcaaactggtgctcaaggccctgtgcaccaaggtgcccgagttgatca
A0A4W2CIX3_BAX-01      cagcaaactggtgctcaaggccctgtgcaccaaggtgcccgagttgatca
A0A4W2H091_BAX-02      cagcaaactggtgctcaaggccctgtgcaccaaggtgcccgagttgatca
A0A3Q1MN40_BAX-02      cagcaaactggtgctcaaggccctgtgcaccaaggtgcccgagttgatca
A0A3Q1MN40_BAX-03      cagcaaactggtgctcaaggccctgtgcaccaaggtgcccgagttgatca
                       **************************************************

A0A4W2H091_BAX-01      ggaccatcatgggctggacattggacttccttcgagagcggctgctgggc
A0A4W2CIX3_BAX-02      ggaccatcatgggctggacattggacttccttcgagagcggctgctgggc
A0A3Q1MN40_BAX-01      ggaccatcatgggctggacattggacttccttcgagagcggctgctgggc
A0A4W2CIX3_BAX-01      ggaccatcatgggctggacattggacttccttcgagagcggctgctgggc
A0A4W2H091_BAX-02      ggaccatcatgggctggacattggacttccttcgagagcggctgctgggc
A0A3Q1MN40_BAX-02      ggaccatcatgggctggacattggacttccttcgagagcggctgctgggc
A0A3Q1MN40_BAX-03      ggaccatcatgggctggacattggacttccttcgagagcggctgctgggc
                       **************************************************

A0A4W2H091_BAX-01      tggatccaggaccagggtggttg---------------------------
A0A4W2CIX3_BAX-02      tggatccaggaccagggtggttg---------------------------
A0A3Q1MN40_BAX-01      tggatccaggaccagggtggttg---------------------------
A0A4W2CIX3_BAX-01      tggatccaggaccagggtggttg---------------------------
A0A4W2H091_BAX-02      tggatccaggaccagggtggttg---------------------------
A0A3Q1MN40_BAX-02      tggatccaggaccagggtggttgggtgagacctctaaccccaccccattc
A0A3Q1MN40_BAX-03      tggatccaggaccagggtggttgggtgagacctctaaccccaccccattc
                       ***********************                           

A0A4W2H091_BAX-01      --------------------------------------------------
A0A4W2CIX3_BAX-02      --------------------------------------------------
A0A3Q1MN40_BAX-01      --------------------------------------------------
A0A4W2CIX3_BAX-01      --------------------------------------------------
A0A4W2H091_BAX-02      --------------------------------------------------
A0A3Q1MN40_BAX-02      ccccactcctctggggcccttgggcctttctgtgcccaccataggagtgc
A0A3Q1MN40_BAX-03      ccccactcctctggggcccttgggcctttctgtgcccaccataggagtgc
                                                                         

A0A4W2H091_BAX-01      --------------------------------------------------
A0A4W2CIX3_BAX-02      --------------------------------------------------
A0A3Q1MN40_BAX-01      --------------------------------------------------
A0A4W2CIX3_BAX-01      --------------------------------------------------
A0A4W2H091_BAX-02      --------------------------------------------------
A0A3Q1MN40_BAX-02      ccccttccccattttggggtcatatgtctgatcaacccctgattcacagg
A0A3Q1MN40_BAX-03      ccccttccccattttggggtcatatgtctgatcaacccctgattcacagg
                                                                         

A0A4W2H091_BAX-01      --------------------------------------------------
A0A4W2CIX3_BAX-02      --------------------------------------------------
A0A3Q1MN40_BAX-01      --------------------------------------------------
A0A4W2CIX3_BAX-01      --------------------------------------------------
A0A4W2H091_BAX-02      --------------------------------------------------
A0A3Q1MN40_BAX-02      gtgcccaatgacctgtccatgacccttgacctccttgtgacctctgacct
A0A3Q1MN40_BAX-03      gtgcccaatgacctgtccatgacccttgacctccttgtgacctctgacct
                                                                         

A0A4W2H091_BAX-01      --------------------------------------------------
A0A4W2CIX3_BAX-02      --------------------------------------------------
A0A3Q1MN40_BAX-01      --------------------------------------------------
A0A4W2CIX3_BAX-01      --------------------------------------------------
A0A4W2H091_BAX-02      --------------------------------------------------
A0A3Q1MN40_BAX-02      cctagtgacccctgacccgatgcctcgatgccctccctggtgcctccctc
A0A3Q1MN40_BAX-03      cctagtgacccctgacccgatgcctcgatgccctccctggtgcctccctc
                                                                         

A0A4W2H091_BAX-01      --------------------------------------------------
A0A4W2CIX3_BAX-02      --------------------------------------------------
A0A3Q1MN40_BAX-01      --------------------------------------------------
A0A4W2CIX3_BAX-01      --------------------------------------------------
A0A4W2H091_BAX-02      --------------------------------------------------
A0A3Q1MN40_BAX-02      caattcctctggaatccctcaagttctatgataatcctttaacttcccca
A0A3Q1MN40_BAX-03      caattcctctggaatccctcaagttctatgataatcctttaacttcccca
                                                                         

A0A4W2H091_BAX-01      --------------------------------------------------
A0A4W2CIX3_BAX-02      --------------------------------------------------
A0A3Q1MN40_BAX-01      --------------------------------------------------
A0A4W2CIX3_BAX-01      --------------------------------------------------
A0A4W2H091_BAX-02      --------------------------------------------------
A0A3Q1MN40_BAX-02      ctcgtaggcccttgcccctacttgtgccctctgacccctccctgctccct
A0A3Q1MN40_BAX-03      ctcgtaggcccttgcccctacttgtgccctctgacccctccctgctccct
                                                                         

A0A4W2H091_BAX-01      --------------------------------------------------
A0A4W2CIX3_BAX-02      --------------------------------------------------
A0A3Q1MN40_BAX-01      --------------------------------------------------
A0A4W2CIX3_BAX-01      --------------------------------------------------
A0A4W2H091_BAX-02      --------------------------------------------------
A0A3Q1MN40_BAX-02      catgtgctggcccaggggctgccccttggctgagtcgctgaagtgcctgc
A0A3Q1MN40_BAX-03      catgtgctggcccaggggctgccccttggctgagtcgctgaagtgcctgc
                                                                         

A0A4W2H091_BAX-01      --------------ggacggcctcctctcctactttgggacacccacatg
A0A4W2CIX3_BAX-02      --------------ggacggcctcctctcctactttgggacacccacatg
A0A3Q1MN40_BAX-01      --------------ggacggcctcctctcctactttgggacacccacatg
A0A4W2CIX3_BAX-01      --------------ggacggcctcctctcctactttgggacacccacatg
A0A4W2H091_BAX-02      --------------ggacggcctcctctcctactttgggacacccacatg
A0A3Q1MN40_BAX-02      tgtccctatccccaggacggcctcctctcctactttgggacacccacatg
A0A3Q1MN40_BAX-03      tgtccctatccccaggacggcctcctctcctactttgggacacccacatg
                                     ************************************

A0A4W2H091_BAX-01      gcagacagtgaccatctttgtggctggagtgctcaccgcctcgctcacca
A0A4W2CIX3_BAX-02      gcagacagtgaccatctttgtggctggagtgctcaccgcctcgctcacca
A0A3Q1MN40_BAX-01      gcagacagtgaccatctttgtggctggagtgctcaccgcctcgctcacca
A0A4W2CIX3_BAX-01      gcagacagtgaccatctttgtggctggagtgctcaccgcctcgctcacca
A0A4W2H091_BAX-02      gcagacagtgaccatctttgtggctggagtgctcaccgcctcgctcacca
A0A3Q1MN40_BAX-02      gcagacagtgaccatctttgtggctggagtgctcaccgcctcgctcacca
A0A3Q1MN40_BAX-03      gcagacagtgaccatctttgtggctggagtgctcaccgcctcgctcacca
                       **************************************************

A0A4W2H091_BAX-01      tctggaagaagatgggctga------------------------------
A0A4W2CIX3_BAX-02      tctggaagaagatgggctga------------------------------
A0A3Q1MN40_BAX-01      tctggaagaagatgggctga------------------------------
A0A4W2CIX3_BAX-01      tctggaagaagatgggctga------------------------------
A0A4W2H091_BAX-02      tctggaagaagatgggctga------------------------------
A0A3Q1MN40_BAX-02      tctggaagaagatgggctgaggccatcaactgccttggactttttctgca
A0A3Q1MN40_BAX-03      tctggaagaagatgggctgaggccatcaactgccttggactttttctgca
                       ********************                              

A0A4W2H091_BAX-01      --------------------------------------------------
A0A4W2CIX3_BAX-02      --------------------------------------------------
A0A3Q1MN40_BAX-01      --------------------------------------------------
A0A4W2CIX3_BAX-01      --------------------------------------------------
A0A4W2H091_BAX-02      --------------------------------------------------
A0A3Q1MN40_BAX-02      taaattatggcatttttcaggggggtggggcggatttgggggccatggag
A0A3Q1MN40_BAX-03      taaattatggcatttttcaggggggtggggcggatttgggggccatggag
                                                                         

A0A4W2H091_BAX-01      ------------------
A0A4W2CIX3_BAX-02      ------------------
A0A3Q1MN40_BAX-01      ------------------
A0A4W2CIX3_BAX-01      ------------------
A0A4W2H091_BAX-02      ------------------
A0A3Q1MN40_BAX-02      tttttcttacttttttaa
A0A3Q1MN40_BAX-03      tttttcttacttttttaa
                                         

© 1998-2023Legal notice