Dataset for CDS BOK of Organism Cyclopterus lumpus

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A8C2ZTT9_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Cyclopterus lumpus GN=BOK (length=642 residues).
atggaggtcctgcggaagtcctctgtgtttgctgcggaggtcctggatgtgtttgaccgatcgttgactgagaaggagct
ggtgacccagtctaaagccctgtgcagagactacatcctgtccagactccaccagaatggactggggtggtccaaaactg
aactccacctctctccgtcaaatgcagcgctcgctgaggcgtcgttggtgcttctctgtcttggcgacgagctggagtgt
atacagcccagtttgtacaggaacgtggcccggcagctcaacatctctgttgccatggagaacatggtttcagatgcctt
catcggcgtggcaacagagatcttctcaacaggtataacatggggtaaggtggtatccatgtatgcggtagccggagccc
tagcagtggactgtgtcagacagggtcatccaaccaccgttcacatcttagtggacagtctgggacagtttgtccgcaag
tttctggttccctggctgaagagacggggaggatgggcggagatcacaaaatgtgtgttgaagcaggatcttacccctga
gcaccactggctgtcgtctgtcatcgagtccctgaagtacttcctcactacagtgtacgtctacatcatgaaggagacat
ga
>gnl|bcl2dbcds|A0A8C3AAM0_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Cyclopterus lumpus GN=BOK (length=672 residues).
atggagatgttgcgccgctcttctgtgttcgcggccgaggtgtttgaccgctcgcccaccgacaaggagctggtgtccca
ggccaaagcgctctgccgggactacattcactcccggctcaaccgcgccgggataggctggtcgaagcccgaccacgggc
gcgctgcgtccggcggggcgctgggagaggtgtcgcccgtcctgctgtggctgggtgacgagttggagtaccttcgaccc
aacgtgtaccgcaacgttgcgcgacagctcaacatcacggtggcctcggagagtatcgtgtccgatgccttcctggctgt
ggctgcagacattttctccacaggtgggtccccgtcggtgtctggtttgtgtctcctgtcaggtgtgacatgggggaagg
tggtgtctttgtacgccgtggcaggagccctggctgtggactgtgttcgccacggccaccccgctatggtccataccatt
gtcgactgcatgggggagtttgtccgcaagagcttgacctcctggttaaaaaggagagggggctgggtggacgtaacgaa
atgcgtggtgaacaccgatcccagcttccgctctcactggctggtgtccgccgtctgcgccttcggacactacctgaagg
ccaccgtgttgtacctcctcagagacacgtga
>gnl|bcl2dbcds|A0A8C3AAM0_BOK-02 BCL2-related ovarian killer gene OS=[Eukaryota] Cyclopterus lumpus GN=BOK (length=591 residues).
atgttgcgccgctcttctgtgttcgcggccgaggtgtttgaccgctcgcccaccgacaaggagctggtgtcccaggccaa
agcgctctgccgggactacattcactcccgcccgaccacgggcgcgctgcgtccggcggggcgctgggagaggtgtcgcc
cgtcctgctgtggtgacgagttggagtaccttcgacccaacgtgtaccgcaacgttgcgcgacagctcaacatcacggtg
gcctcggagagtatcgtgtccgatgccttcctggctgtggctgcagacattttctccacaggtgtgacatgggggaaggt
ggtgtctttgtacgccgtggcaggagccctggctgtggactgtgttcgccacggccaccccgctatggtccataccattg
tcgactgcatgggggagtttgtccgcaagagcttgacctcctggttaaaaaggagagggggctgggtggacgtaacgaaa
tgcgtggtgaacaccgatcccagcttccgctctcactggctggtgtccgccgtctgcgccttcggacactacctgaaggc
caccgtgttgtacctcctcagagacacgtga
© 1998-2023Legal notice