Dataset for CDS MCL-1 of organism Oncorhynchus tshawytscha

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C8LPV9_MCL1-01      atgagtctgtcgaagtcgattgcacgagccacaactacgatgttgcattt
A0A8C8CMB3_MCL1-01      atgagtctgtcgaagtcgattacacgagccacaactacgatgttgaattt
A0A8C8CMB3_MCL1-02      atgagtctgtcgaagtcgattacacgagccacaactacgatgttgaattt
                        ********************* *********************** ****

A0A8C8LPV9_MCL1-01      tcaaaa---------tggaggatcttcgtacctagctgatgatgctagcc
A0A8C8CMB3_MCL1-01      tcaaaatggagtcgttggaggctcttcgtaccctgctgg------tacct
A0A8C8CMB3_MCL1-02      tcaaaatggagtcgttggaggctcttcgtaccctgctgg------tacct
                        ******         ****** **********  ****       ** * 

A0A8C8LPV9_MCL1-01      ctttgtactatttcgac------ggggccgtatgtgctggggcgtcaccg
A0A8C8CMB3_MCL1-01      ctttgtactatttcggcgagactggggctgtacgtgctggggcgtcaccg
A0A8C8CMB3_MCL1-02      ctttgtactatttcggcgagactggggctgtacgtgctggggcgtcaccg
                        *************** *      ***** *** *****************

A0A8C8LPV9_MCL1-01      aagtctaaagtg------gacttgggaaatgggactggcgatact---cc
A0A8C8CMB3_MCL1-01      aagtcaaaagtggatactgacttgggtaatgggactggcgacactccacc
A0A8C8CMB3_MCL1-02      aagtcaaaagtggatactgacttgggtaatgggactggcgacactccacc
                        ***** ******      ******** ************** ***   **

A0A8C8LPV9_MCL1-01      acgacccacgacgttaggaatgaatgtcgtgaaaaccaacgtcctcgata
A0A8C8CMB3_MCL1-01      acgacccacgaagttaggagtgaatgtcgtgaaaagcaacgtcctgggta
A0A8C8CMB3_MCL1-02      acgacccacgaagttaggagtgaatgtcgtgaaaagcaacgtcctgggta
                        *********** ******* *************** ********* * **

A0A8C8LPV9_MCL1-01      atcatttgtcagaccgaagcaacaatgacga---------ttctttgccc
A0A8C8CMB3_MCL1-01      atcatttgtcagaccgaagcaacaatgacgactctgacggttctttgccc
A0A8C8CMB3_MCL1-02      atcatttgtcagaccgaagcaacaatgacgactctgacggttctttgccc
                        *******************************         **********

A0A8C8LPV9_MCL1-01      tgcactcctcagatggcgtcagaatgtgggcctgaactatcgaattgtcc
A0A8C8CMB3_MCL1-01      tgcactcctcagatggcgtcagaatgtgggcctgaactatcgaattgtca
A0A8C8CMB3_MCL1-02      tgcactcctcagatggcgtcagaatgtgggcctgaactatcgaattgtca
                        ************************************************* 

A0A8C8LPV9_MCL1-01      atcgggcgatgaagtattggaacatgataccagacaactcattgagaatt
A0A8C8CMB3_MCL1-01      atcgggcgatgaagtattggaacatgatacaagacaactaattgaaaacg
A0A8C8CMB3_MCL1-02      atcgggcgatgaagtattggaacatgatacaagacaactaattgaaaacg
                        ****************************** ******** ***** **  

A0A8C8LPV9_MCL1-01      ttttgggggactacacaggactgtctcagcctcgatggaagcaaagcaag
A0A8C8CMB3_MCL1-01      tattggtggactatacaggactgactccgtctcgttgtaagcaaagcaag
A0A8C8CMB3_MCL1-02      tattggtggactatacaggactgactccgtctcgttgtaagcaaagcaag
                        * **** ****** ********* *** * **** ** ************

A0A8C8LPV9_MCL1-01      cctcttacgaccatgaagcgagtggtggaggacgtaatagcaaagcaccg
A0A8C8CMB3_MCL1-01      gctcttacgacgatgaagcgagtggtgaaggatataatagcaaagcaccg
A0A8C8CMB3_MCL1-02      gctcttacgacgatgaagcgagtggtgaaggatataatagcaaagcaccg
                         ********** *************** ****  ****************

A0A8C8LPV9_MCL1-01      atatgcatacaatggtatggtcgtcaaacttgacttggatgatcgatgcg
A0A8C8CMB3_MCL1-01      atacgcatacaatggtatgatcgccaaacttgatttagatgaccgatgcg
A0A8C8CMB3_MCL1-02      atacgcatacaatggtatgatcgccaaacttgatttagatgaccgatgcg
                        *** *************** *** ********* ** ***** *******

A0A8C8LPV9_MCL1-01      atgacatgagcgtcgtcaattctgtggccaagaccatgttcagtgatggg
A0A8C8CMB3_MCL1-01      atgacatgagtttcatcaattctgtggccaagaccctgttcagtgatggg
A0A8C8CMB3_MCL1-02      atgacatgagtttcatcaattctgtggccaagaccctgttcagtgatggg
                        **********  ** ******************** **************

A0A8C8LPV9_MCL1-01      atcacgaactggggtcgcatcgccagcctggtggcatttggcgcagtggt
A0A8C8CMB3_MCL1-01      accacgaactggggtcgcatcgccagcctggtggcatttggagcagtggt
A0A8C8CMB3_MCL1-02      accacgaactggggtcgcatcgccagcctggtggcatttggagcagtggt
                        * *************************************** ********

A0A8C8LPV9_MCL1-01      gagccagcacctgaaggagagtggcaggggacactgcgttgatttggtgg
A0A8C8CMB3_MCL1-01      gagccagcacttgaaggagattggcaggggacactgcattgagtctgtgg
A0A8C8CMB3_MCL1-02      gagccagcacttgaaggagattggcaggggacactgcattgagtctgtgg
                        ********** ********* **************** **** *  ****

A0A8C8LPV9_MCL1-01      gccaagagattgccacatacctcctctctgaccaaagggactggctggtc
A0A8C8CMB3_MCL1-01      gccaaaagatcaccacatacctcctctctgaccaaagggactggctggtc
A0A8C8CMB3_MCL1-02      gccaaaagatcaccacatacctcctctctgaccaaagggactggctggtc
                        ***** ****  **************************************

A0A8C8LPV9_MCL1-01      aaaaacaatgcttggaatggatttgtagagttctttcatgttcaagatcc
A0A8C8CMB3_MCL1-01      aaaaacaatgcttggaatggatttgtagagttctttcatgtgcaagatcc
A0A8C8CMB3_MCL1-02      aaaaacaatgcttggaatggatttgtagagttctttcatgtgcaagatcc
                        ***************************************** ********

A0A8C8LPV9_MCL1-01      tgagtcctcggtaaggaacaccctcctagcctttgctggagttgctggga
A0A8C8CMB3_MCL1-01      agagtcctcagtaaggaacaccctcatagcctttgctggatttgctgggc
A0A8C8CMB3_MCL1-02      agagtcctcagtaaggaacaccctcatagcctttgctggatttgctgggc
                         ******** *************** ************** ******** 

A0A8C8LPV9_MCL1-01      ttggggcaacacttgccatgttgatcag----------------------
A0A8C8CMB3_MCL1-01      ttggggcaactctcgccatgttgatcag----------------------
A0A8C8CMB3_MCL1-02      ttggggcaactctcgccatgttgatcagccaaccaccaatacagaatcaa
                        ********** ** **************                      

A0A8C8LPV9_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-02      atacctgtagctcaggagtggattactagcatacctgtggtggtgttctc
                                                                          

A0A8C8LPV9_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-01      --------------------------------gaa---------------
A0A8C8CMB3_MCL1-02      ttcacccagtggttgcaagcacactcattacagaataacacctcacctaa
                                                                          

A0A8C8LPV9_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-02      ggggtgtcagtgtaaatgacgttgggtccttgagccgccacaggctcccc
                                                                          

A0A8C8LPV9_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-02      tgcctcagccggctcatcgggctttcatgcctcagccggatcgccagact
                                                                          

A0A8C8LPV9_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-02      cccctgcctcagccggctcatcgggctttcatgcctctgccagatcgcaa
                                                                          

A0A8C8LPV9_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-02      gactcccctgcttccaccggcttgtcaggatctcatgcctcagccggtct
                                                                          

A0A8C8LPV9_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-02      gtcaggttcccgcgccccagccggctcgacaggttcccgcgcctcagccg
                                                                          

A0A8C8LPV9_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-01      -------------------ttcagcag-----------------------
A0A8C8CMB3_MCL1-02      acgtgacaggtttccacgcttcagcaggggtcaccaatctgctcctgatc
                                                                          

A0A8C8LPV9_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-02      cctgggtttgtctcccttatcggcgccctgcggctggagccgcgcgtcgg
                                                                          

A0A8C8LPV9_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-01      --------------------------------------------attag-
A0A8C8CMB3_MCL1-02      ggagggggcagtgtcacgtatactctctctccgacctctaggtcatcagg
                                                                          

A0A8C8LPV9_MCL1-01      ---gtga
A0A8C8CMB3_MCL1-01      -------
A0A8C8CMB3_MCL1-02      ctgctga
                               

© 1998-2023Legal notice