Dataset for CDS BAX of Organism Canis lupus dingo

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C0LPP9_BAX-01 BCL2-associated X gene OS=[Eukaryota] Canis lupus dingo GN=BAX (length=579 residues).
atggacgggtccggggagcaacccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaagatcgagcagggcgaatggggggagagacacctgagctgcccttggagcaggtgccccaggatg
catccaccaagaagctgagcgaatgtctcaagcgcatcggagatgaactggacagtaacatggagttgcagaggatgatc
gcagctgtggacacagactctccccgtgaggtcttcttccgagtggcagctgagatgttttctgatggcaacttcaactg
gggccgggttgttgccctcttctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgagctgatca
ggaccatcatgggctggacactggacttccttcgagagcggctgctgggctggatccaggaccagggtggttgggacggc
ctcctctcctactttgggacacccacgtggcagacagtgaccatctttgtggctggagtgcttactgcgtcactcaccat
ctggaaaaagatgggctga
© 1998-2023Legal notice