Dataset for CDS Unclassified of Organism Leptotrombidium deliense

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A443ST11_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Leptotrombidium deliense (length=462 residues).
atgtatacatgtatgaatgatgttcaatattttaatttgctattgctgtgtagtggcattgaagatggttacgccaatgc
gttgatggcgtcaatcggaagagatttgcgacgtatcgcagaagaggtcgaacgaagcagtgaaagagaaaggattcgtc
gaagagcttctgagatcgacatttatggagtaaagtatgaccagtttcgacaactgttggaagaactgtttacgaatggc
ataaacagaaccaggatcgtcgtattgttcttcttttgtactgatgtggctctgagagcttatcattcttatccaaccga
atactgttgtcggttgttaaagtggtcagtcaggttcataatggacacgatttgtgattgggtgcagcgaaatggtggat
gggtaatttattcttcattttacagtctttttgtacaatttttgtatctttacagagtgtag
© 1998-2023Legal notice