Dataset for CDS Unclassified of organism Oryzias sinensis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C7Y4Z1_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oryzias sinensis (length=678 residues).
accgtcattcagagactacgaccgccagtgtccgacccctgctcagggactcctacaaatggtctgagagtacgaccacc
acacgagctaaatcagaacaacctgtcagtgaaggcggcgcaaagaaacttttacggctttgttattcgaggagtagaac
gcaacatggatggggaaactagatacgtgatcagaagcgttctgggacacttcgttggacgacgcggagacttcgaggtc
gacatgctgagttgtcgcgaagctgtgtgtgctatgacaagagctgtatgtgatgtgctggaagtccacagactgaaata
cataggtgagccacaccaactgatctcggttttctcatctgtgagccttttcgaggacgggataatcaactggggccgca
tcgtcagtcttgtaagtttaggggccgcgttgtgccaacatcagaacagggtcgacagaggcaacggctctctcttggct
gacaccgtgtcagaggcgatcgcctcgtacttgctcacagaacacagaggatggctggaagagaggcgttgggataactt
cgttgactttttcccttcacccaaagccacaggacgttacgaccgtgtgggacctgcacttgggctctttgttttcacgg
tcggaactgcacttttgtgcagctaccttgtgatgtga
© 1998-2023Legal notice