Dataset for CDS BOK of organism Branchiostoma lanceolatum

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A8J9Z0D8_BOK-06 BCL2-related ovarian killer gene OS=[Eukaryota] Branchiostoma lanceolatum GN=BOK (length=825 residues).
atggatctggtgggaggggaaggcggtgtggatcaacctctgccttccctagacgaggaacacgaacatgattctgacgg
ggaagaagtagagactatcgactccagcggggaggagggcagaggtgtatcggcacgtgtgcggaaattcctgcgggagt
tcagcgtcaaggcctgcttcaggagtgccaaggactcggtactggatttacgacaatacgtgctggacgtgcctgaaact
cttaaagcttcgctatggtcccaggcagcacccacagaaaagtccgttatcgacgagtccagacagctcatacgggacta
catcaacggtcgcctgaagaaatctaacctcacccgcgggagacttcccgatgccaaacgaagaccaactgaggtgtcgt
cccagcttcagaagatgggaggggagctagagaggatgtacccacacctgtaccgggacgtgtccagacagatcaacatc
acgctgtcgtcagagtccatcctcgagaccagttttgagacggttgctaacgaactgttcagtacggggatcacgtgggc
acgggttgtggcgatgtttgcggtggccggggccttcgccgtggactgtgttcaccagggacatcccatgttcacacgcc
ggctggtggacatcgtggtggacttcacggacaggaaactgtcatcgtggctcgtacaggaaggaggatggtacggacta
gtgaaacactttcgaggagacgggaggacaaacatgttctgggcgattagcgggatcggagcagccattggtctagccgc
aactttcttcgtcattgacctttga
>gnl|bcl2dbcds|A0A8J9Z0D8_BOK-07 BCL2-related ovarian killer gene OS=[Eukaryota] Branchiostoma lanceolatum GN=BOK (length=633 residues).
atgccacgtcgtaggaaacgaagctcagttgcaagtcaactcttcacatcatgggcttcgctatggtcccaggcagcacc
cacagaaaagtccgttatcgacgagtccagacagctcatacgggactacatcaacggtcgcctgaagaaatctaacctca
cccgcgggagacttcccgatgccaaacgaagaccaactgaggtgtcgtcccagcttcagaagatgggaggggagctagag
aggatgtacccacacctgtaccgggacgtgtccagacagatcaacatcacgctgtcgtcagagtccatcctcgagaccag
ttttgagacggttgctaacgaactgttcagtacggggatcacgtgggcacgggttgtggcgatgtttgcggtggccgggg
ccttcgccgtggactgtgttcaccagggacatcccatgttcacacgccggctggtggacatcgtggtggacttcacggac
aggaaactgtcatcgtggctcgtacaggaaggaggatggtacggactagtgaaacactttcgaggagacgggaggacaaa
catgttctgggcgattagcgggatcggagcagccattggtctagccgcaactttcttcgtcattgacctttga
>gnl|bcl2dbcds|A0A8J9Z0D8_BOK-08 BCL2-related ovarian killer gene OS=[Eukaryota] Branchiostoma lanceolatum GN=BOK (length=609 residues).
atgttacgtacacgtcgcagattacgccgggcttcgctatggtcccaggcagcacccacagaaaagtccgttatcgacga
gtccagacagctcatacgggactacatcaacggtcgcctgaagaaatctaacctcacccgcgggagacttcccgatgcca
aacgaagaccaactgaggtgtcgtcccagcttcagaagatgggaggggagctagagaggatgtacccacacctgtaccgg
gacgtgtccagacagatcaacatcacgctgtcgtcagagtccatcctcgagaccagttttgagacggttgctaacgaact
gttcagtacggggatcacgtgggcacgggttgtggcgatgtttgcggtggccggggccttcgccgtggactgtgttcacc
agggacatcccatgttcacacgccggctggtggacatcgtggtggacttcacggacaggaaactgtcatcgtggctcgta
caggaaggaggatggtacggactagtgaaacactttcgaggagacgggaggacaaacatgttctgggcgattagcgggat
cggagcagccattggtctagccgcaactttcttcgtcattgacctttga
© 1998-2023Centre National de la Recherche Scientifique logoInstitut national de la sante et de la recherche médicale logoUniversité de Lyon logoLegal notice