Dataset for CDS BCL-2-like of organism Taeniopygia guttata

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


H0Z8G3_BCL2L1-01        --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A674HQK4_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-02      atgggagtcaggggacgaagtgggtggtccgttttccgccgaaaaaacgg
A0A674GNG3_BCL2-02      --------------------------------------------------
A0A674GNG3_BCL2-04      --------------------------------------------------
A0A674GNG3_BCL2-01      --------------------------------------------------
A0A674GNG3_BCL2-03      --------------------------------------------------
                                                                          

H0Z8G3_BCL2L1-01        ------------------------------------------------at
H0ZCL9_BCL2A1-01        ------------------------------------------------at
A0A674HQK4_MCL1-01      ---------------------------------------atcgctaagaa
A0A674HQK4_MCL1-02      aagcggaggtggaaaaaaaaaaaaaaaacaaacccaaaaatcaaaaaaaa
A0A674GNG3_BCL2-02      ------------------------------------------------at
A0A674GNG3_BCL2-04      ------------------------------------------------at
A0A674GNG3_BCL2-01      ------------------------------------------------at
A0A674GNG3_BCL2-03      ------------------------------------------------at
                                                                        * 

H0Z8G3_BCL2L1-01        g-------------------------------------------------
H0ZCL9_BCL2A1-01        g-------------------------------------------------
A0A674HQK4_MCL1-01      gct------------------------ttttccgg---------------
A0A674HQK4_MCL1-02      gctctcgctgtcccgccctcgccccgcctctccggcgtcaccggttatat
A0A674GNG3_BCL2-02      gctgctcctggccgccgccttcatcgtggccttcg-tcctcctcctctac
A0A674GNG3_BCL2-04      gctgctcctggccgccgccttcatcgtggccttcg-tcctcctcctctac
A0A674GNG3_BCL2-01      g-------------------------------------------------
A0A674GNG3_BCL2-03      g-------------------------------------------------
                        *                                                 

H0Z8G3_BCL2L1-01        --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A674HQK4_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-02      aacgcggccgcgccggtcccgcccgcaccccgccggccgctcgcaccggg
A0A674GNG3_BCL2-02      atggtgtcgccgcttatcagccccaagtccctgaagctgcccggcgcgca
A0A674GNG3_BCL2-04      atggtgtcgccgcttatcagccccaagtccctgaagctgcccggcgcgca
A0A674GNG3_BCL2-01      -----------gctcat-----------------------ccggggagaa
A0A674GNG3_BCL2-03      -----------gctcat-----------------------ccggggagaa
                                                                          

H0Z8G3_BCL2L1-01        ----------------tacagcagt--aaccgggagtt------------
H0ZCL9_BCL2A1-01        -------------------------gaaactgctgagttctattacgttt
A0A674HQK4_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-02      cgcc----------atgttcgccgtgaagccgaaagctttcatcggcttc
A0A674GNG3_BCL2-02      cgtcgtggtaactggaggctccagtggaattggaaaatgtattgctattg
A0A674GNG3_BCL2-04      cgtcgtggtaactggaggctccagtggaattggaaaatgtattgctattg
A0A674GNG3_BCL2-01      --------------gaggctacgat--aaccgggagat------------
A0A674GNG3_BCL2-03      --------------gaggctacgat--aaccgggagat------------
                                                                          

H0Z8G3_BCL2L1-01        agtgat------tgactttgtttcctacaagctctcacagaaaggataca
H0ZCL9_BCL2A1-01        attacttagcccaggattatct----gcagtatgtgctccaggaatcaca
A0A674HQK4_MCL1-01      ---------------gtcttctc------------------gg---tggg
A0A674HQK4_MCL1-02      aacctctactgcggcggctcccc------------------ggggctgag
A0A674GNG3_BCL2-02      aatgctataagcaaggtgctttc---ataacactgattgcaagggatgag
A0A674GNG3_BCL2-04      aatgctataagcaaggtgctttc---ataacactgattgcaagggatgag
A0A674GNG3_BCL2-01      agtgct------gaagtacatccactataaactctctcagaggggatacg
A0A674GNG3_BCL2-03      agtgct------gaagtacatccactataaactctctcagaggggatacg
                                                                          

H0Z8G3_BCL2L1-01        gctggagtcagctggaagaggaggatgagaacaggactg-----------
H0ZCL9_BCL2A1-01        cctcg-gaccagcccagacccggg--------------------------
A0A674HQK4_MCL1-01      cccgg-g-cggcccggggcggcgg--------------------------
A0A674HQK4_MCL1-02      ccccg-c-ggggccggaaccgcggccggagcctcaccgggaccctcaccg
A0A674GNG3_BCL2-02      aataa-g-ctgttgcagacgaaga-aggaaatagaaaagtactctgttaa
A0A674GNG3_BCL2-04      aataa-g-ctgttgcagacgaaga-aggaaatagaaaagtactctgttaa
A0A674GNG3_BCL2-01      actgg-g-c---tgccggcgaggacagggcat---------ccctg----
A0A674GNG3_BCL2-03      actgg-g-c---tgccggcgaggacagggcat---------ccctg----
                                              *                           

H0Z8G3_BCL2L1-01        --------------------------------------------------
H0ZCL9_BCL2A1-01        ----------------------------ttgctcatgtcctgaga-----
A0A674HQK4_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-02      ggaccctcaccgggaccccgcggagcctcaccgggaacaccgcggggcca
A0A674GNG3_BCL2-02      tgacaagca--ggttgtactctgtatttctgttgatgtctcgaaagacta
A0A674GNG3_BCL2-04      tgacaagca--ggttgtactctgtatttctgttgatgtctcgaaagacta
A0A674GNG3_BCL2-01      ---cctcca--gat--cactccg--cttctgctgctgctgcga-------
A0A674GNG3_BCL2-03      ---cctcca--gat--cactccg--cttctgctgctgctgcga-------
                                                                          

H0Z8G3_BCL2L1-01        --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A674HQK4_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-02      ccggcggcagcgccgaccccccccgcgcgctgattgg---tcgaggcgcg
A0A674GNG3_BCL2-02      cgaacaggtggagaatgttctcaaacaggctcaggagaagttggggccag
A0A674GNG3_BCL2-04      cgaacaggtggagaatgttctcaaacaggctcaggagaagttggggccag
A0A674GNG3_BCL2-01      ----------------------------------------ttg----ctg
A0A674GNG3_BCL2-03      ----------------------------------------ttg----ctg
                                                                          

H0Z8G3_BCL2L1-01        ------------------------------actttgcaggggaggaggac
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A674HQK4_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-02      gcgccgcgctcgctgattggctgcggcgcgactctctggcgccccgagga
A0A674GNG3_BCL2-02      ttgacatgcttgtaaactgtgcaggaacatcagttacaggaaaatttgag
A0A674GNG3_BCL2-04      ttgacatgcttgtaaactgtgcaggaacatcagttacaggaaaatttgag
A0A674GNG3_BCL2-01      ctgctgcgattg------------------ctgctgctgggacttctgat
A0A674GNG3_BCL2-03      ctgctgcgattg------------------ctgctgctgggacttctgat
                                                                          

H0Z8G3_BCL2L1-01        gagatggacgggg-------------------------------------
H0ZCL9_BCL2A1-01        -------------------------------------------accatgg
A0A674HQK4_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-02      ggaactggacggatgcgaccccgaacccgaacgcggctccgccgcc----
A0A674GNG3_BCL2-02      gatattgaagtgaattcttttgaaagattaatggcagtcaattacctggg
A0A674GNG3_BCL2-04      gatattgaagtgaattcttttgaaagattaatggcagtcaattacctggg
A0A674GNG3_BCL2-01      cacactgggctg--------------------------------------
A0A674GNG3_BCL2-03      cacactgggctg--------------------------------------
                                                                          

H0Z8G3_BCL2L1-01        -------tcctcaacgggagcccctcc-----------------------
H0ZCL9_BCL2A1-01        catcctctctgcaagaccaaac----------------------------
A0A674HQK4_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-02      --gccgcttcgctgcccgggaccccccccgggaccccgcccggagctccg
A0A674GNG3_BCL2-02      gagtgtttacccaagccgag------------------------------
A0A674GNG3_BCL2-04      gagtgtttacccaagccgag------------------------------
A0A674GNG3_BCL2-01      --gtgtctccgcaccccgagcccccc------------------------
A0A674GNG3_BCL2-03      --gtgtctccgcaccccgagcccccc------------------------
                                                                          

H0Z8G3_BCL2L1-01        -------------------------tggcacgcggccaccagccacatag
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A674HQK4_MCL1-01      -------------------------------------------------g
A0A674HQK4_MCL1-02      gatgggctccggcaggactcgctggagctcatcagccgctacctgc---g
A0A674GNG3_BCL2-02      -----------------------------cagtaatcgcta-ccatgaag
A0A674GNG3_BCL2-04      -----------------------------cagtaatcgcta-ccatgaag
A0A674GNG3_BCL2-01      -------------------------ggctcggctactgctagccac--ac
A0A674GNG3_BCL2-03      -------------------------ggctcggctactgctagccac--ac
                                                                          

H0Z8G3_BCL2L1-01        tga-------atggagccaccgtgcaccagaacagcctcgaagtccatga
H0ZCL9_BCL2A1-01        ------------ggagg---------------------ag----------
A0A674HQK4_MCL1-01      ggatgcggtgatggag------------aaggcgctggag----------
A0A674HQK4_MCL1-02      ggaggtggctggggaggagcagcccagcaaggcgctggag----------
A0A674GNG3_BCL2-02      gaacgcagaatgggaaggattgt-ctttgtatcatcccag----------
A0A674GNG3_BCL2-04      gaacgcagaatgggaaggattgt-ctttgtatcatcccag----------
A0A674GNG3_BCL2-01      gcccccagcc---gaggggctgcgccctg---caccccag----------
A0A674GNG3_BCL2-03      gcccccagcc---gaggggctgcgccctg---caccccag----------
                                     **                        *          

H0Z8G3_BCL2L1-01        gatccgtcgagcagctgatgtgaggcaggcgctgagagaggcgggggatg
H0ZCL9_BCL2A1-01        ----------------gctgtcaggccgctcctggaca-------ggatt
A0A674HQK4_MCL1-01      ----------------acgctgcggagggtcggggacggtgtgatgagga
A0A674HQK4_MCL1-02      ----------------acgctgcggagggtcggggacggtgtgatgagga
A0A674GNG3_BCL2-02      ----------------gctgggcagttaggcctgttt--------ggat-
A0A674GNG3_BCL2-04      ----------------gctgggcagttaggcctgttt--------ggat-
A0A674GNG3_BCL2-01      ----------------gccgtccacctcgtcctacgccaggcgggggatg
A0A674GNG3_BCL2-03      ----------------gccgtccacctcgtcctacgccaggcgggggatg
                                                                     *    

H0Z8G3_BCL2L1-01        agttt----------------gagctgaggtaccggcgggcgttcagcga
H0ZCL9_BCL2A1-01        gacatcac--------------------ctctgtagcggctgccaagaga
A0A674HQK4_MCL1-01      aacac----------------gagctggcttttcaaggaatgctgcggaa
A0A674HQK4_MCL1-02      aacac----------------gagctggcttttcaaggaatgctgcggaa
A0A674GNG3_BCL2-02      -atacagcttattctcccacgaaatttgctcttcgagggttggctgaagc
A0A674GNG3_BCL2-04      -atacagcttattctcccacgaaatttgctcttcgagggttggctgaagc
A0A674GNG3_BCL2-01      agttctcccgacgctaccagagagacttttcccaaatgtctggccag---
A0A674GNG3_BCL2-03      agttctcccgacgctaccagagagacttttcccaaatgtctggccag---
                                                             *   *        

H0Z8G3_BCL2L1-01        cct---------------cacttcccagctccacatcac-----------
H0ZCL9_BCL2A1-01        attttcaatgga--------------------------------------
A0A674HQK4_MCL1-01      gctgcggatcca--------------------------------------
A0A674HQK4_MCL1-02      gctgcggatcca--------------------------------------
A0A674GNG3_BCL2-02      cctgcaaatggaggtaaaaccttacaatgtctacgtaacagtggcctatc
A0A674GNG3_BCL2-04      cctgcaaatggaggtaaaaccttacaatgtctacgtaacagtggcctatc
A0A674GNG3_BCL2-01      -ctgc-------------acctgacgccctttaca---------------
A0A674GNG3_BCL2-03      -ctgc-------------acctgacgccctttaca---------------
                          *                                               

H0Z8G3_BCL2L1-01        -tcccagcacagcgtatcagagctttg-agcaggtagt-gaacgaactgt
H0ZCL9_BCL2A1-01        ---------------------gtcatggatgaaaag-------------t
A0A674HQK4_MCL1-01      -gcgagaagaagac-ctgcaggcggtggtggaggtggc-tgcccacctct
A0A674HQK4_MCL1-02      -gcgagaagaagac-ctgcaggcggtggtggaggtggc-tgcccacctct
A0A674GNG3_BCL2-02      ctccagatactgatactcctggctttgcagaagaaagtaaaacaaagccc
A0A674GNG3_BCL2-04      ctccagatactgatactcctggctttgcagaagaaagtaaaacaaagccc
A0A674GNG3_BCL2-01      -gccaggagccgct--tcgtggcggtggtggaggagct----------ct
A0A674GNG3_BCL2-03      -gccaggagccgct--tcgtggcggtggtggaggagct----------ct
                                             *   **    *                  

H0Z8G3_BCL2L1-01        tccgcgatggag---tgaactggggccgcatcgtggctttcttctccttc
H0ZCL9_BCL2A1-01        ttgctgatggaaatactaactggggacgaatcatgaccatctttacattt
A0A674HQK4_MCL1-01      tcagcgacggggtgaccaactggggccgggtggtgacgctcatctccttc
A0A674HQK4_MCL1-02      tcagcgacggggtgaccaactggggccgggtggtgacgctcatctccttc
A0A674GNG3_BCL2-02      ttagagacgaag---ctaattt--------ctgagac------ctcatct
A0A674GNG3_BCL2-04      ttagagacgaag---ctaattt--------ctgagac------ctcatct
A0A674GNG3_BCL2-01      tccgagatgggg---ttaactggggcagaattgtggc------cttcttc
A0A674GNG3_BCL2-03      tccgagatgggg---ttaactggggcagaattgtggc------cttcttc
                        *    ** *        ** *             * *          *  

H0Z8G3_BCL2L1-01        g---------------------gaggagccttgtgcgtggagagcgt---
H0ZCL9_BCL2A1-01        gg--------------aggtcttctcaccaagaagcttcaagagcatggg
A0A674HQK4_MCL1-01      g---------------gagccttcgtggccaagcacctgaagagcat---
A0A674HQK4_MCL1-02      g---------------gagccttcgtggccaagcacctgaagagcat---
A0A674GNG3_BCL2-02      gtttgccaagcagaacaagttgccagagttata---gtgaaagatgc---
A0A674GNG3_BCL2-04      gtttgccaagcagaacaagttgccagagttata---gtgaaagatgc---
A0A674GNG3_BCL2-01      g---------------agtttggcggtgtgatgtgtgtggagagcgt---
A0A674GNG3_BCL2-03      g---------------agtttggcggtgtgatgtgtgtggagagcgt---
                        *                                    *  *         

H0Z8G3_BCL2L1-01        -----------tgttaaggagat------gagggtattggtgaaacgcat
H0ZCL9_BCL2A1-01        gttcagctgactgcagaggagaa------------------ggagcagat
A0A674HQK4_MCL1-01      -----------ccagcaggagca----------------gggcatcggct
A0A674HQK4_MCL1-02      -----------ccagcaggagca----------------gggcatcggct
A0A674GNG3_BCL2-02      -----------catacaagggaa--tttcaacagctctgttggatcagat
A0A674GNG3_BCL2-04      -----------catacaagggaa--tttcaacagctctgttggatcagat
A0A674GNG3_BCL2-01      -----------ca-acagggagatgtttc-----ccctcgtggacaacat
A0A674GNG3_BCL2-03      -----------ca-acagggagatgtttc-----ccctcgtggacaacat
                                        * *                      * *     *

H0Z8G3_BCL2L1-01        cgtctcttg-----------gatgaccacgtacttgaccgaccacttaga
H0ZCL9_BCL2A1-01        ttcttatt----tcatcacggagtacatcataaacaacaaagc-------
A0A674HQK4_MCL1-01      gcctggctgccatcatcaccgagg-----------cgctggtctcctcca
A0A674HQK4_MCL1-02      gcctggctgccatcatcaccgagg-----------cgctggtctcctcca
A0A674GNG3_BCL2-02      ggttacatgctgtcaatattgacaagtg-gaatgtcaccagtcacttcta
A0A674GNG3_BCL2-04      ggttacatgctgtcaatattgacaagtg-gaatgtcaccagtcacttcta
A0A674GNG3_BCL2-01      tgccacctg-----------gatgactgagtacctgaaccggcacctgca
A0A674GNG3_BCL2-03      tgccacctg-----------gatgactgagtacctgaaccggcacctgca
                               *            **                    *       

H0Z8G3_BCL2L1-01        --------tccctggatccaggagaatggcggatgg-------gagcgct
H0ZCL9_BCL2A1-01        --------tgaatggattgatgcgaatggtggctgggaa----aatggct
A0A674HQK4_MCL1-01      agagggagtggctgg----agagccaggggggctgg-------gggggct
A0A674HQK4_MCL1-02      agagggagtggctgg----agagccaggggggctgg-------gggggct
A0A674GNG3_BCL2-02      --------ttactga----aggtcttcagcag-----------gatgcct
A0A674GNG3_BCL2-04      --------ttactga----aggtcttcagcag-----------gttgttt
A0A674GNG3_BCL2-01      --------caactggatccaggacaacggaggctgg-------gatgcct
A0A674GNG3_BCL2-03      --------caactggatccaggacaacggaggctggtcacagagagggca
                                    **     *        *  *                  

H0Z8G3_BCL2L1-01        ttgtgg---acctctatggga--------------------------acg
H0ZCL9_BCL2A1-01        tcctaactaagtttgaaagaa-------------------gatcactact
A0A674HQK4_MCL1-01      tcgtgg---acttcttccgcc--------------tggaggacct--gga
A0A674HQK4_MCL1-02      tcgtgg---acttcttccgcc--------------tggaggacct--gga
A0A674GNG3_BCL2-02      ttgtgg---agttgtatggca--------acaatatga--ggcctttgtt
A0A674GNG3_BCL2-04      gcatgg---gcatttttcgca--------tcatt------ggcct-----
A0A674GNG3_BCL2-01      ttgtgg---agttgtatggca--------acaatatga--ggcctttgtt
A0A674GNG3_BCL2-03      gcgtaaaatagctgcgaggcaattcccgtacagtaaaatggaagtctctt
                           *        *     *                               

H0Z8G3_BCL2L1-01        atgctgctgccgagatgagaaaaggccaggagaccttcaacaa-------
H0ZCL9_BCL2A1-01        gtccttctccaaaattacagccctgttc--atagctcttgtgt-------
A0A674HQK4_MCL1-01      gggcagcgtccgga--------acgttctgatggccttcgcgg-------
A0A674HQK4_MCL1-02      gggcagcgtccgga--------acgttctgatggccttcgcgg-------
A0A674GNG3_BCL2-02      tgatttctcctgga--------tctctctgaagactatcctga-------
A0A674GNG3_BCL2-04      --attttacctagg--------aagttttgacagc-atagttc-------
A0A674GNG3_BCL2-01      tgatttctcctgga--------tctctctgaagactatcctga-------
A0A674GNG3_BCL2-03      tggctcttcattcaatacaatgtggctcaagaggatatcctgccaaacca
                                                                          

H0Z8G3_BCL2L1-01        ---------------------------------atggctcc------tga
H0ZCL9_BCL2A1-01        ---------------------------------------cc------ttg
A0A674HQK4_MCL1-01      ----------------------------------gggtggc------cgg
A0A674HQK4_MCL1-02      ----------------------------------gggtggc------cgg
A0A674GNG3_BCL2-02      --------------------------------------gtc------tgg
A0A674GNG3_BCL2-04      --------------------------------------gtcgctgcatga
A0A674GNG3_BCL2-01      --------------------------------------gtc------tgg
A0A674GNG3_BCL2-03      atgataacgagggaaataaagtcacttcctcaccagctgtt------tga
                                                                          

H0Z8G3_BCL2L1-01        cgggggcgacggtggccggagtg-----cttctgctgggatccctgctga
H0ZCL9_BCL2A1-01        ttcaga-------------------------------------------g
A0A674HQK4_MCL1-01      cctggg-------ggccagcctg-----------------gcctacctga
A0A674HQK4_MCL1-02      cctggg-------ggccagcctg-----------------gcctacctga
A0A674GNG3_BCL2-02      ttctgg-------tgggagcttgcatcactct----tggcgcttatcttg
A0A674GNG3_BCL2-04      tgcaaa-------gggaaa--------aatct----gaaagtgcagataa
A0A674GNG3_BCL2-01      ttctgg-------tgggagcttgcatcactct----tggcgcttatcttg
A0A674GNG3_BCL2-03      ttcaggatgcctttgtggagttgtatggcaacaatatgaggcctttgttt
                                                                          

H0Z8G3_BCL2L1-01        gccgcaagtga
H0ZCL9_BCL2A1-01        agtactactga
A0A674HQK4_MCL1-01      tcc---ggtga
A0A674HQK4_MCL1-02      tcc---ggtga
A0A674GNG3_BCL2-02      gacataagtag
A0A674GNG3_BCL2-04      gac-cgagtaa
A0A674GNG3_BCL2-01      gacataagtag
A0A674GNG3_BCL2-03      ga---------
                                   

© 1998-2023Legal notice