Dataset for CDS BCL-2-like of organism Taeniopygia guttata

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


H0Z8G3_BCL2L1-01      atgtacagcagtaaccgggagttagtga--ttgactttgtttcctacaag
H0ZCL9_BCL2A1-01      at--------------ggaaactgctgagttctattacgtttattac---
                      **              ** *  *  ***  *  * *  ****  ***   

H0Z8G3_BCL2L1-01      ctctcacagaaaggatacagctggagtcagctggaagaggaggatgagaa
H0ZCL9_BCL2A1-01      --------------------------------------------ttagcc
                                                                  * **  

H0Z8G3_BCL2L1-01      caggactgactttgcaggggaggaggacgagatggacggggtcctcaacg
H0ZCL9_BCL2A1-01      caggatta--tctgcag--------------------tatgtgctc--ca
                      ***** *   * *****                       ** ***  * 

H0Z8G3_BCL2L1-01      ggagcccctcctggcacgcggccaccagccacatagtgaatggagccacc
H0ZCL9_BCL2A1-01      ggaatcacacctcggac-cagcccagacccgggttgctcatg----tcct
                      ***  * * *** * ** * ***   * **   * *   ***      * 

H0Z8G3_BCL2L1-01      gtgcaccagaacagcctcgaagtccatgagatccgtcgagcagctgatgt
H0ZCL9_BCL2A1-01      gagaaccatggcatcctc----tctgcaagaccaaacg-gaggaggctgt
                      * * ****   ** ****    **    *** *   ** *  *  * ***

H0Z8G3_BCL2L1-01      gaggcaggcgctgagagaggcgggggatgagtttgagctgaggtaccggc
H0ZCL9_BCL2A1-01      caggccgctcct------------ggacaggattg---------------
                       **** *   **            ***   * ***               

H0Z8G3_BCL2L1-01      gggcgttcagcgacctcacttcccagctccacatcactcccagcacagcg
H0ZCL9_BCL2A1-01      ------------------------------acatcacctctgtagcggct
                                                    *******  *     * ** 

H0Z8G3_BCL2L1-01      tatcagag---ctttgagcaggtagtgaacgaactgttccgcgatgga--
H0ZCL9_BCL2A1-01      gccaagagaattttcaatggagtcatggatgaaaagtttgctgatggaaa
                          ****    **  *    **  ** * ***  ***    ******  

H0Z8G3_BCL2L1-01      -gtgaactggggccgcatcgtggctttcttctccttcggaggagccttgt
H0ZCL9_BCL2A1-01      tactaactggggacgaatcatgaccatctttacatttggag--gtcttct
                          ******** ** *** ** *  ****  * ** ****  * *** *

H0Z8G3_BCL2L1-01      ---------gcgtggagagcgt--tgttaaggagatgagggtattggtga
H0ZCL9_BCL2A1-01      caccaagaagcttcaagagcatggggttcagctgactgcagaggagaagg
                               ** *  ***** *   *** **  **     *    *  * 

H0Z8G3_BCL2L1-01      aacgcatcgtctcttggatgaccacgtacttgaccgaccacttagatccc
H0ZCL9_BCL2A1-01      agcagatttcttatttcatcacggagtacatcataaacaacaaagctgaa
                      * *  **    * **  ** **   **** * *   ** **  ** *   

H0Z8G3_BCL2L1-01      tggatccaggagaatggcggatgggagcgctttgtggacctctatgggaa
H0ZCL9_BCL2A1-01      tggattgatgcgaatggtggctgggaaa-----atggcttcct-----aa
                      *****  * * ****** ** *****        ***    **     **

H0Z8G3_BCL2L1-01      cgatgctgctgccgagatgagaaaaggccagga--gaccttcaacaa---
H0ZCL9_BCL2A1-01      ctaagtt----------tgaaagaagatcactactgtccttctccaaaat
                      * * * *          *** * ***  **  *  * *****  ***   

H0Z8G3_BCL2L1-01      -------------atggctcctgacgggggcgacggtggccggagtgctt
H0ZCL9_BCL2A1-01      tacagccctgttcatagctctt--------------------gtgtcctt
                                   ** **** *                    * ** ***

H0Z8G3_BCL2L1-01      ctgctgggatccctgctgagccgcaagtga
H0ZCL9_BCL2A1-01      gttcagagagtactactga-----------
                       * * * **   ** ****           

© 1998-2020Legal notice