Dataset for CDS BCL-2-like of organism Taeniopygia guttata

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|H0Z8G3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Taeniopygia guttata GN=BCL2L1 (length=693 residues).
atgtacagcagtaaccgggagttagtgattgactttgtttcctacaagctctcacagaaaggatacagctggagtcagct
ggaagaggaggatgagaacaggactgactttgcaggggaggaggacgagatggacggggtcctcaacgggagcccctcct
ggcacgcggccaccagccacatagtgaatggagccaccgtgcaccagaacagcctcgaagtccatgagatccgtcgagca
gctgatgtgaggcaggcgctgagagaggcgggggatgagtttgagctgaggtaccggcgggcgttcagcgacctcacttc
ccagctccacatcactcccagcacagcgtatcagagctttgagcaggtagtgaacgaactgttccgcgatggagtgaact
ggggccgcatcgtggctttcttctccttcggaggagccttgtgcgtggagagcgttgttaaggagatgagggtattggtg
aaacgcatcgtctcttggatgaccacgtacttgaccgaccacttagatccctggatccaggagaatggcggatgggagcg
ctttgtggacctctatgggaacgatgctgctgccgagatgagaaaaggccaggagaccttcaacaaatggctcctgacgg
gggcgacggtggccggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|H0ZCL9_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Taeniopygia guttata GN=BCL2A1 (length=525 residues).
atggaaactgctgagttctattacgtttattacttagcccaggattatctgcagtatgtgctccaggaatcacacctcgg
accagcccagacccgggttgctcatgtcctgagaaccatggcatcctctctgcaagaccaaacggaggaggctgtcaggc
cgctcctggacaggattgacatcacctctgtagcggctgccaagagaattttcaatggagtcatggatgaaaagtttgct
gatggaaatactaactggggacgaatcatgaccatctttacatttggaggtcttctcaccaagaagcttcaagagcatgg
ggttcagctgactgcagaggagaaggagcagatttcttatttcatcacggagtacatcataaacaacaaagctgaatgga
ttgatgcgaatggtggctgggaaaatggcttcctaactaagtttgaaagaagatcactactgtccttctccaaaattaca
gccctgttcatagctcttgtgtccttgttcagagagtactactga
© 1998-2020Legal notice