Dataset for CDS BCL2L1 of organism Sander lucioperca

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C9WU15_BCL2L1-      ---------atgtctcaa---aacagagaactggtggctttctacataaa
A0A8D0AAQ8_BCL2L1-      atggaaataatgttgtacagtaacagagagctggtggagttctttataag
                                 ****   *    ******** *******  ****  **** 

A0A8C9WU15_BCL2L1-      ctataaactctcccagagaaactat----cctctcaaccacatgggactc
A0A8D0AAQ8_BCL2L1-      ctacaagctgtctcagagaaactattcaacctctctgc----tgaggcca
                        *** ** ** ** ************    ******  *    ** * *  

A0A8C9WU15_BCL2L1-      atagagccttcgaacaggactgatggggggcacgcagggttggttgagga
A0A8D0AAQ8_BCL2L1-      gaggatgctggcagaaggactgaaggagacaaggccaactcagctgc---
                           **  **   *  ******** ** *   * **    *  * **    

A0A8C9WU15_BCL2L1-      ggagagggtagcgacgcacgccaacgggactttgaacggcacgagtcccg
A0A8D0AAQ8_BCL2L1-      --------cagtaacg---gcctgctggtc----aacagccgaaatgggg
                                 **  ***   ***  * ** *    *** **   * *   *

A0A8C9WU15_BCL2L1-      ggaccccaccagcgtccccgctgcggcagcaacagttggcgtctacgacg
A0A8D0AAQ8_BCL2L1-      gcggccagccagggatgtcgttgc-----ccccacgtggtg---------
                        *   **  **** *    ** ***     *  **  *** *         

A0A8C9WU15_BCL2L1-      agcctggacgcagtgaaagaggccctccgggactccgccaacgagtttga
A0A8D0AAQ8_BCL2L1-      -acatagaggctgtaaaggcagctcttcaggactcagcaaatgagtttga
                          * * ** ** ** ** *  ** ** * ****** ** ** ********

A0A8C9WU15_BCL2L1-      gctgcgatacgcccgcgccttcagcgatctgcacaaccagctgcacatca
A0A8D0AAQ8_BCL2L1-      actgctcttcacacaagcgtttagtgacctctcctcgcagctagacatca
                         ****  * * * *  ** ** ** ** **   *   *****  ******

A0A8C9WU15_BCL2L1-      cgccagccacggcctaccaaagcttcgagaacgtgatggatgaggtgttc
A0A8D0AAQ8_BCL2L1-      ctcctgacacagcctaccacagctttaagagcgtgatggacgaggtgttc
                        * ** * *** ******** *****  *** ********* *********

A0A8C9WU15_BCL2L1-      cgggacggggtcaactggggccgcatcgtagggctttttgctttcggcgg
A0A8D0AAQ8_BCL2L1-      aaggatggaatcaactggggtcgtgtagtgggtctgtttgcctttggcgg
                          *** **  ********** **  * ** ** ** ***** ** *****

A0A8C9WU15_BCL2L1-      ggctctgtgcgtggagtgcgtggagaaggagatgagtccgctggtgggca
A0A8D0AAQ8_BCL2L1-      cgtgctgtgtgtggaatgtgtagagaaggatatgagcgagctggtttccc
                         *  ***** ***** ** ** ******** *****   ******   * 

A0A8C9WU15_BCL2L1-      ggatcattgagtggatgacggtttacctggacaaccacattcagccctgg
A0A8D0AAQ8_BCL2L1-      gcatcgcagactggatgaccatgtacctggatgagcacatcagtccatgg
                        * ***   ** ********  * ********  * *****    ** ***

A0A8C9WU15_BCL2L1-      atccagagccaaggaggatgggagcgctttgccgaaatcttcgggcagga
A0A8D0AAQ8_BCL2L1-      atccagagccaaggaggatgggactgctttgctgaggttttcgggcgaga
                        ***********************  ******* **  * *******  **

A0A8C9WU15_BCL2L1-      cgcggcggcagagagcaggcggtctcaggagagtttcaagaagtggctgc
A0A8D0AAQ8_BCL2L1-      cggcgctgcagaagcgaggagatctcaggagactatgagaagatggctgc
                        **  ** *****    *** * ********** * * *  *  *******

A0A8C9WU15_BCL2L1-      tggcgggtatgaccctggtgaccggagtcgtggtgggctcactcatcgcc
A0A8D0AAQ8_BCL2L1-      tagttggagtggcgctgctaatgggagtgctggttggtgtggccatcgct
                        * *  **  ** * *** * *  *****  **** **      ****** 

A0A8C9WU15_BCL2L1-      cagaaacgcctgtga
A0A8D0AAQ8_BCL2L1-      aagaaacg---atga
                         *******    ***

© 1998-2023Legal notice