Dataset for CDS BCL2L1 of organism Sander lucioperca

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A8C9WU15_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Sander lucioperca GN=BCL2L1 (length=699 residues).
atgtctcaaaacagagaactggtggctttctacataaactataaactctcccagagaaactatcctctcaaccacatggg
actcatagagccttcgaacaggactgatggggggcacgcagggttggttgaggaggagagggtagcgacgcacgccaacg
ggactttgaacggcacgagtcccgggaccccaccagcgtccccgctgcggcagcaacagttggcgtctacgacgagcctg
gacgcagtgaaagaggccctccgggactccgccaacgagtttgagctgcgatacgcccgcgccttcagcgatctgcacaa
ccagctgcacatcacgccagccacggcctaccaaagcttcgagaacgtgatggatgaggtgttccgggacggggtcaact
ggggccgcatcgtagggctttttgctttcggcggggctctgtgcgtggagtgcgtggagaaggagatgagtccgctggtg
ggcaggatcattgagtggatgacggtttacctggacaaccacattcagccctggatccagagccaaggaggatgggagcg
ctttgccgaaatcttcgggcaggacgcggcggcagagagcaggcggtctcaggagagtttcaagaagtggctgctggcgg
gtatgaccctggtgaccggagtcgtggtgggctcactcatcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A8D0AAQ8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Sander lucioperca GN=BCL2L1 (length=675 residues).
atggaaataatgttgtacagtaacagagagctggtggagttctttataagctacaagctgtctcagagaaactattcaac
ctctctgctgaggccagaggatgctggcagaaggactgaaggagacaaggccaactcagctgccagtaacggcctgctgg
tcaacagccgaaatgggggcggccagccagggatgtcgttgcccccacgtggtgacatagaggctgtaaaggcagctctt
caggactcagcaaatgagtttgaactgctcttcacacaagcgtttagtgacctctcctcgcagctagacatcactcctga
cacagcctaccacagctttaagagcgtgatggacgaggtgttcaaggatggaatcaactggggtcgtgtagtgggtctgt
ttgcctttggcggcgtgctgtgtgtggaatgtgtagagaaggatatgagcgagctggtttcccgcatcgcagactggatg
accatgtacctggatgagcacatcagtccatggatccagagccaaggaggatgggactgctttgctgaggttttcgggcg
agacggcgctgcagaagcgaggagatctcaggagactatgagaagatggctgctagttggagtggcgctgctaatgggag
tgctggttggtgtggccatcgctaagaaacgatga
© 1998-2023Legal notice