Dataset for CDS BCL-2 of organism Falco tinnunculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C4U538_BCL2-01      cagaggaacatatttatagtccaagctcatccggggagaagaggctacga
A0A8C4U538_BCL2-02      ---------------at------ggctcatccggggagaagaggctacga
                                       **       **************************

A0A8C4U538_BCL2-01      taaccgggagatagtgctgaagtacatccactataaactctcgcagcggg
A0A8C4U538_BCL2-02      taaccgggagatagtgctgaagtacatccactataaactctcgcagcggg
                        **************************************************

A0A8C4U538_BCL2-01      gatacgactgggctgccggcgaggacagggcacccctgcctccaggtctc
A0A8C4U538_BCL2-02      gatacgactgggctgccggcgaggacagggcacccctgcctccaggtctc
                        **************************************************

A0A8C4U538_BCL2-01      tctcctcctgctgctgctgctgcggttgctgctgctgctgctgctgggac
A0A8C4U538_BCL2-02      tctcctcctgctgctgctgctgcggttgctgctgctgctgctgctgggac
                        **************************************************

A0A8C4U538_BCL2-01      ttcctctgatcacactgggctggtgtctccgcaccccgagccccccggct
A0A8C4U538_BCL2-02      ttcctctgatcacactgggctggtgtctccgcaccccgagccccccggct
                        **************************************************

A0A8C4U538_BCL2-01      cggctgctgctagccacgtgcccccggctgaggggctgcgccccgcaccc
A0A8C4U538_BCL2-02      cggctgctgctagccacgtgcccccggctgaggggctgcgccccgcaccc
                        **************************************************

A0A8C4U538_BCL2-01      caggttgtccacctcaccctgcgccaggcgggggacgagttctcccgccg
A0A8C4U538_BCL2-02      caggttgtccacctcaccctgcgccaggcgggggacgagttctcccgccg
                        **************************************************

A0A8C4U538_BCL2-01      ctaccagagggactttgcccaaatgtctggccagttgcacctgacgccct
A0A8C4U538_BCL2-02      ctaccagagggactttgcccaaatgtctggccagttgcacctgacgccct
                        **************************************************

A0A8C4U538_BCL2-01      tcacggccaggggccgcttcgtggcggtggtggaggagctcttccgagat
A0A8C4U538_BCL2-02      tcacggccaggggccgcttcgtggcggtggtggaggagctcttccgagat
                        **************************************************

A0A8C4U538_BCL2-01      ggggttaactggggcaggattgtggccttcttcgagttcggcggcgtgat
A0A8C4U538_BCL2-02      ggggttaactggggcaggattgtggccttcttcgagttcggcggcgtgat
                        **************************************************

A0A8C4U538_BCL2-01      gtgcgtggagagtgtcaacagggagatgtctcccctcgtagacagcatcg
A0A8C4U538_BCL2-02      gtgcgtggagagtgtcaacagggagatgtctcccctcgtagacagcatcg
                        **************************************************

A0A8C4U538_BCL2-01      ctgcctggatgaccgagtacctgaaccggcacctgcacaactggatccag
A0A8C4U538_BCL2-02      ctgcctggatgaccgagtacctgaaccggcacctgcacaactggatccag
                        **************************************************

A0A8C4U538_BCL2-01      gacaacggaggctggg------------------------------tacg
A0A8C4U538_BCL2-02      gacaacggaggctgggatgccttcgtggagttgtatggcaacagtatgag
                        ****************                              *  *

A0A8C4U538_BCL2-01      tcccccgattgctcgttcc-----ctctc-----------------ctgg
A0A8C4U538_BCL2-02      gcctttgtttgatttctcctggatctctctgaagactatcctgagtctgg
                         **   * *** *   ***     *****                 ****

A0A8C4U538_BCL2-01      ctctggtgcacagccagtggggctccggg--------gtgggc---agta
A0A8C4U538_BCL2-02      ttctggtg-ggagcttgcatcactcttggcgcttatcttggacataagta
                         *******   ***  *     ***  **         *** *   ****

A0A8C4U538_BCL2-01      -
A0A8C4U538_BCL2-02      g
                         

© 1998-2023Legal notice