Dataset for CDS BCL-2 of organism Falco tinnunculus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A8C4U538_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Falco tinnunculus GN=BCL-2 (length=687 residues).
cagaggaacatatttatagtccaagctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatcca
ctataaactctcgcagcggggatacgactgggctgccggcgaggacagggcacccctgcctccaggtctctctcctcctg
ctgctgctgctgcggttgctgctgctgctgctgctgggacttcctctgatcacactgggctggtgtctccgcaccccgag
ccccccggctcggctgctgctagccacgtgcccccggctgaggggctgcgccccgcaccccaggttgtccacctcaccct
gcgccaggcgggggacgagttctcccgccgctaccagagggactttgcccaaatgtctggccagttgcacctgacgccct
tcacggccaggggccgcttcgtggcggtggtggaggagctcttccgagatggggttaactggggcaggattgtggccttc
ttcgagttcggcggcgtgatgtgcgtggagagtgtcaacagggagatgtctcccctcgtagacagcatcgctgcctggat
gaccgagtacctgaaccggcacctgcacaactggatccaggacaacggaggctgggtacgtcccccgattgctcgttccc
tctcctggctctggtgcacagccagtggggctccggggtgggcagta
>gnl|bcl2dbcds|A0A8C4U538_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Falco tinnunculus GN=BCL-2 (length=729 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctcgcagcgggg
atacgactgggctgccggcgaggacagggcacccctgcctccaggtctctctcctcctgctgctgctgctgcggttgctg
ctgctgctgctgctgggacttcctctgatcacactgggctggtgtctccgcaccccgagccccccggctcggctgctgct
agccacgtgcccccggctgaggggctgcgccccgcaccccaggttgtccacctcaccctgcgccaggcgggggacgagtt
ctcccgccgctaccagagggactttgcccaaatgtctggccagttgcacctgacgcccttcacggccaggggccgcttcg
tggcggtggtggaggagctcttccgagatggggttaactggggcaggattgtggccttcttcgagttcggcggcgtgatg
tgcgtggagagtgtcaacagggagatgtctcccctcgtagacagcatcgctgcctggatgaccgagtacctgaaccggca
cctgcacaactggatccaggacaacggaggctgggatgccttcgtggagttgtatggcaacagtatgaggcctttgtttg
atttctcctggatctctctgaagactatcctgagtctggttctggtgggagcttgcatcactcttggcgcttatcttgga
cataagtag
© 1998-2023Legal notice