Dataset for CDS Unclassified of organism Bombus impatiens

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A6P3DRA3_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Bombus impatiens (length=894 residues).
atggccggcgacgacggtgcaccaccggacaatgagatcctcacggatggagaggggcagggtgcgtcagtgcgggggga
accgcattccagagtgggcggcatcctggaatgcgatccccccggtaacaagaattcgtcgagccagcgagtctctaacg
acaacgactacgccggcggaagcgctgatactgtgattccacaggatcgtaacggaggcggtggaacaccgattgccggt
gataacggcgctctgtgccgatatgctatcggcactgcacataccgctatgtcttttatcgaagtttgtcagatccgatt
gcagaacttttttccgcagctgatttcgtcttcgcggtatactctctgcgaagattccatagaacgaacagcagagtgtt
tagccaacgatgtgatacggtatctactgaaggaagatatatatctgatatctcaagacccagtttcccgtagtatgaga
cacaacgtgtatcaaatgttgaataaacatagtattctcttcgcaagtatggtaaatcgtctaaacgttgtgccagatac
ggcatacgaagcgttcatgggagttgcggacgaattgttcttacacggtggagttacatgggcgagaatcgtttgtctat
atgcattcatgggcagactcgctctgtgggcacgggatagacgaatgcacactctaaagaaaaaattacctctttacgtc
tccagatttattggtgagaaagttgcacatttcatcaaaggatacggtggatgggagcaactgtgtatagaataccctgt
ggcagaagaaataagtggagcaatttggagaagtcttataatgacaggtgctacacttggtttggttgcaacgatcttaa
cagtgacctcctga
© 1998-2023Legal notice