Dataset for CDS BCL2A1 of organism Sarcophilus harrisii

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A7N4P573_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Sarcophilus harrisii GN=BCL2A1 (length=606 residues).
atggcggctgcggcggctctcagcggatttaagcgcaacctgcgggccgagatgaagcagcggctgcgggcgctcagcgc
cgaggaacggctccgtcagtcccgcctgctgacagagaaggtgattgctcacagtaaatatcaagagtctcagagaattt
caatctttctaagcatgcaggatgaaattgagacagaagaaattatcaaggatatttttaaacaaggcaaaacatgtttt
atccctcgatacaaattcaatagtaactacatggatatggtcaggttattttcagctgaagaaattttttcacttcccaa
aacatcctggaacattcatcagcctggtgatgatgaagtacgggaggaggctttgtctaccgggggtctggatctcatct
tcatgccaggtcttggatttgaccaacagggaaaccgcctgggaagggggaagggatactatgacacttacctgaagaga
tgcttccaacaccaaaaaagaagaccttacacaattgctttggctttcaaagagcagatctgtgatgcagtgccagtggg
agaagatgatatgagaatagatgaagtgctctatgaagacaaataa
>gnl|bcl2dbcds|A0A7N4P573_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Sarcophilus harrisii GN=BCL2A1 (length=906 residues).
atggctgattgtgaattccattatgttcacatgctagcccaggactacttgaagcatgttcaacaaatgccacgactggg
atcatgtctacataggacatctcaaatacttcaaaaagttgctttctctgtccaagaagaagttgaaaaggatatggaaa
cattcttgagcactttggacattacttctgtagattgtgccagaagaattttcaacagtgttatggaaaaggaatttgag
gatggcatcatcaactggggacggattgtcaccatatttgcttttgggggaattctcattaagaaacttctgagacacag
agctccactgactatggacactcatgaagaaatttctcattttattgctgagttcataatgaacaacatagcagaatgga
taagacaaaatggaggatgggtgattgctcacagtaaatatcaagagtctcagagaatttcaatctttctaagcatgcag
gatgaaattgagacagaagaaattatcaaggatatttttaaacaaggcaaaacatgttttatccctcgatacaaattcaa
tagtaactacatggatatggtcaggttattttcagctgaagaaattttttcacttcccaaaacatcctggaacattcatc
agcctggtgatgatgaagtacgggaggaggctttgtctaccgggggtctggatctcatcttcatgccaggtcttggattt
gaccaacagggaaaccgcctgggaagggggaagggatactatgacacttacctgaagagatgcttccaacaccaaaaaag
aagaccttacacaattgctttggctttcaaagagcagatctgtgatgcagtgccagtgggagaagatgatatgagaatag
atgaagtgctctatgaagacaaataa
>gnl|bcl2dbcds|A0A7N4P573_BCL2A1-03 BCL2-related protein A1 gene OS=[Eukaryota] Sarcophilus harrisii GN=BCL2A1 (length=513 residues).
atggctgattgtgaattccattatgttcacatgctagcccaggactacttgaagcatgttcaacaaatgccacgactggg
atcatgtctacataggacatctcaaatacttcaaaaagttgctttctctgtccaagaagaagttgaaaaggatatggaaa
cattcttgagcactttggacattacttctgtagattgtgccagaagaattttcaacagtgttatggaaaaggaatttgag
gatggcatcatcaactggggacggattgtcaccatatttgcttttgggggaattctcattaagaaacttctgagacacag
agctccactgactatggacactcatgaagaaatttctcattttattgctgagttcataatgaacaacatagcagaatgga
taagacaaaatggaggatggggggtctggatctcatcttcatgccaggtcttggatttgaccaacagggaaaccgcctgg
gaagggggaagggatactatgacacttacctga
>gnl|bcl2dbcds|A0A7N4P573_BCL2A1-04 BCL2-related protein A1 gene OS=[Eukaryota] Sarcophilus harrisii GN=BCL2A1 (length=519 residues).
atggctgattgtgaattccattatgttcacatgctagcccaggactacttgaagcatgttcaacaaatgccacgactggg
atcatgtctacataggacatctcaaatacttcaaaaagttgctttctctgtccaagaagaagttgaaaaggatatggaaa
cattcttgagcactttggacattacttctgtagattgtgccagaagaattttcaacagtgttatggaaaaggaatttgag
gatggcatcatcaactggggacggattgtcaccatatttgcttttgggggaattctcattaagaaacttctgagacacag
agctccactgactatggacactcatgaagaaatttctcattttattgctgagttcataatgaacaacatagcagaatgga
taagacaaaatggaggatgggaaaatggcttcataaagaactttgaacccaatatggtatggccaaacttcacagatatt
tcaacaaagatctggaatgtattttcctttctgaagtaa
© 1998-2022Legal notice