Dataset for CDS BCL2A1 of organism Sarcophilus harrisii

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A7N4P573_BCL2A1-      atggcggctgcggcggctctcagcggatttaagcgcaacctgcgggccga
A0A7N4P573_BCL2A1-      atggctgat--tgtgaattccattatgttcacatgctagcc-caggacta
A0A7N4P573_BCL2A1-      atggctgat--tgtgaattccattatgttcacatgctagcc-caggacta
A0A7N4P573_BCL2A1-      atggctgat--tgtgaattccattatgttcacatgctagcc-caggacta
                        ***** * *   * *  *  **     ** *   ** * *  * ** * *

A0A7N4P573_BCL2A1-      gatgaagcagcggctgcgggcgctcagcgccgagga--acggctccgtca
A0A7N4P573_BCL2A1-      cttgaagcatgttcaacaaatgcc--acgactgggatcatgtctacatag
A0A7N4P573_BCL2A1-      cttgaagcatgttcaacaaatgcc--acgactgggatcatgtctacatag
A0A7N4P573_BCL2A1-      cttgaagcatgttcaacaaatgcc--acgactgggatcatgtctacatag
                          *******    *  *    **    ** *  ***  * * ** * *  

A0A7N4P573_BCL2A1-      g---tcccgcctgctgacagagaaggtgattgctcacagtaaatatc---
A0A7N4P573_BCL2A1-      gacatctcaaatact--tcaaaaagttgctttctc--------tgtccaa
A0A7N4P573_BCL2A1-      gacatctcaaatact--tcaaaaagttgctttctc--------tgtccaa
A0A7N4P573_BCL2A1-      gacatctcaaatact--tcaaaaagttgctttctc--------tgtccaa
                        *   ** *   * **     * *** ** ** ***        * **   

A0A7N4P573_BCL2A1-      --aagagtctcagagaattt--caatctttctaagcatgcaggatg----
A0A7N4P573_BCL2A1-      gaagaagttgaaaaggatatggaaacattcttgagcactttggacattac
A0A7N4P573_BCL2A1-      gaagaagttgaaaaggatatggaaacattcttgagcactttggacattac
A0A7N4P573_BCL2A1-      gaagaagttgaaaaggatatggaaacattcttgagcactttggacattac
                          *  ***   * ** ** *   **  **  * ****    ***      

A0A7N4P573_BCL2A1-      ------aaattgagacagaagaaattatcaaggatatt------------
A0A7N4P573_BCL2A1-      ttctgtagattgtgccagaag-aattttcaacagtgttatggaaaaggaa
A0A7N4P573_BCL2A1-      ttctgtagattgtgccagaag-aattttcaacagtgttatggaaaaggaa
A0A7N4P573_BCL2A1-      ttctgtagattgtgccagaag-aattttcaacagtgttatggaaaaggaa
                              * **** * ****** **** ****   * **            

A0A7N4P573_BCL2A1-      tttaaacaaggca----------------------aaacatgttttatcc
A0A7N4P573_BCL2A1-      tttgaggatggcatcatcaactggggacggattgtcaccatattt--gct
A0A7N4P573_BCL2A1-      tttgaggatggcatcatcaactggggacggattgtcaccatattt--gct
A0A7N4P573_BCL2A1-      tttgaggatggcatcatcaactggggacggattgtcaccatattt--gct
                        *** *  * ****                       * *** ***   * 

A0A7N4P573_BCL2A1-      ctcgatacaaattcaat--agtaactacatggatatgg---tcaggttat
A0A7N4P573_BCL2A1-      tttgggggaattctcattaagaaacttctgagacacagagctccactgac
A0A7N4P573_BCL2A1-      tttgggggaattctcattaagaaacttctgagacacagagctccactgac
A0A7N4P573_BCL2A1-      tttgggggaattctcattaagaaacttctgagacacagagctccactgac
                         * *    ** *   **  ** **** *   ** *  *   **   * * 

A0A7N4P573_BCL2A1-      tttcagc-----tgaagaaattt----tttcacttcccaaaacatcctgg
A0A7N4P573_BCL2A1-      tatggacactcatgaagaaatttctcattttattgctgagttcataatga
A0A7N4P573_BCL2A1-      tatggacactcatgaagaaatttctcattttattgctgagttcataatga
A0A7N4P573_BCL2A1-      tatggacactcatgaagaaatttctcattttattgctgagttcataatga
                        * *   *     ***********    *** * * *  *   ***  ** 

A0A7N4P573_BCL2A1-      aacattcatcagcctggtgatgatgaagtacgggagg-------------
A0A7N4P573_BCL2A1-      acaacatagcagaatggataagacaaaatggaggat--------------
A0A7N4P573_BCL2A1-      acaacatagcagaatggataagacaaaatggaggatgggtgattgctcac
A0A7N4P573_BCL2A1-      acaacatagcagaatggataagacaaaatggaggatg-------------
                        *  *   * ***  ***  * **  ** *   ***               

A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      agtaaatatcaagagtctcagagaatttcaatctttctaagcatgcagga
A0A7N4P573_BCL2A1-      --------------------------------------------------
                                                                          

A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      tgaaattgagacagaagaaattatcaaggatatttttaaacaaggcaaaa
A0A7N4P573_BCL2A1-      --------------------------------------------------
                                                                          

A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      catgttttatccctcgatacaaattcaatagtaactacatggatatggtc
A0A7N4P573_BCL2A1-      --------------------------------------------------
                                                                          

A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      aggttattttcagctgaagaaattttttcacttcccaaaacatcctggaa
A0A7N4P573_BCL2A1-      --------------------------------------------------
                                                                          

A0A7N4P573_BCL2A1-      -----------------------------------aggctttgtctaccg
A0A7N4P573_BCL2A1-      -------------------------------------------------g
A0A7N4P573_BCL2A1-      cattcatcagcctggtgatgatgaagtacgggaggaggctttgtctaccg
A0A7N4P573_BCL2A1-      -------------------------------------------------g
                                                                         *

A0A7N4P573_BCL2A1-      ggggtctggatctcatcttcatgccaggtcttggatttgaccaacaggga
A0A7N4P573_BCL2A1-      ggaaaatgg-------cttcataaagaactttgaac----ccaatatggt
A0A7N4P573_BCL2A1-      ggggtctggatctcatcttcatgccaggtcttggatttgaccaacaggga
A0A7N4P573_BCL2A1-      ggggtctggatctcatcttcatgccaggtcttggatttgaccaacaggga
                        **    ***       ******        *** *     **** * ** 

A0A7N4P573_BCL2A1-      aaccgcctgggaagggggaagggatactatgacacttacctgaagagatg
A0A7N4P573_BCL2A1-      a------tggccaaacttcacagatatttcaacaaagatctgg-------
A0A7N4P573_BCL2A1-      aaccgcctgggaagggggaagggatactatgacacttacctgaagagatg
A0A7N4P573_BCL2A1-      aaccgcctgggaagggggaagggatactatgacacttacctga-------
                        *      ***  *      *  **** *   ***   * ***        

A0A7N4P573_BCL2A1-      cttccaacaccaaaaaagaagaccttacacaattgctttggctttcaaag
A0A7N4P573_BCL2A1-      ------------------------------aatgtattttcctttctg--
A0A7N4P573_BCL2A1-      cttccaacaccaaaaaagaagaccttacacaattgctttggctttcaaag
A0A7N4P573_BCL2A1-      --------------------------------------------------
                                                                          

A0A7N4P573_BCL2A1-      agcagatctgtgatgcagtgccagtgggagaagatgatatgagaatagat
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      agcagatctgtgatgcagtgccagtgggagaagatgatatgagaatagat
A0A7N4P573_BCL2A1-      --------------------------------------------------
                                                                          

A0A7N4P573_BCL2A1-      gaagtgctctatgaagacaaataa
A0A7N4P573_BCL2A1-      ------------------aagtaa
A0A7N4P573_BCL2A1-      gaagtgctctatgaagacaaataa
A0A7N4P573_BCL2A1-      ------------------------
                                                

© 1998-2021Legal notice