Dataset for CDS BCL2A1 of organism Sarcophilus harrisii

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G3WSP8_BCL2A1-01      atggcggctgcggcggctctcagcggatttaagcgcaacctgcgggccga
G3WSP8_BCL2A1-04      atggctgat--tgtgaattccattatgttcacatgctagcc-caggacta
G3WSP8_BCL2A1-02      atggctgat--tgtgaattccattatgttcacatgctagcc-caggacta
G3WSP8_BCL2A1-03      atggctgat--tgtgaattccattatgttcacatgctagcc-caggacta
                      ***** * *   * *  *  **     ** *   ** * *  * ** * *

G3WSP8_BCL2A1-01      gatgaagcagcggctgcgggcgctcagcgccgagga--acggctccgtca
G3WSP8_BCL2A1-04      cttgaagcatgttcaacaaatgcc--acgactgggatcatgtctacatag
G3WSP8_BCL2A1-02      cttgaagcatgttcaacaaatgcc--acgactgggatcatgtctacatag
G3WSP8_BCL2A1-03      cttgaagcatgttcaacaaatgcc--acgactgggatcatgtctacatag
                        *******    *  *    **    ** *  ***  * * ** * *  

G3WSP8_BCL2A1-01      g---tcccgcctgctgacagagaaggtgattgctcacagtaaatatc---
G3WSP8_BCL2A1-04      gacatctcaaatact--tcaaaaagttgctttctc--------tgtccaa
G3WSP8_BCL2A1-02      gacatctcaaatact--tcaaaaagttgctttctc--------tgtccaa
G3WSP8_BCL2A1-03      gacatctcaaatact--tcaaaaagttgctttctc--------tgtccaa
                      *   ** *   * **     * *** ** ** ***        * **   

G3WSP8_BCL2A1-01      --aagagtctcagagaattt--caatctttctaagcatgcaggatg----
G3WSP8_BCL2A1-04      gaagaagttgaaaaggatatggaaacattcttgagcactttggacattac
G3WSP8_BCL2A1-02      gaagaagttgaaaaggatatggaaacattcttgagcactttggacattac
G3WSP8_BCL2A1-03      gaagaagttgaaaaggatatggaaacattcttgagcactttggacattac
                        *  ***   * ** ** *   **  **  * ****    ***      

G3WSP8_BCL2A1-01      ------aaattgagacagaagaaattatcaaggatatt------------
G3WSP8_BCL2A1-04      ttctgtagattgtgccagaag-aattttcaacagtgttatggaaaaggaa
G3WSP8_BCL2A1-02      ttctgtagattgtgccagaag-aattttcaacagtgttatggaaaaggaa
G3WSP8_BCL2A1-03      ttctgtagattgtgccagaag-aattttcaacagtgttatggaaaaggaa
                            * **** * ****** **** ****   * **            

G3WSP8_BCL2A1-01      tttaaacaaggca----------------------aaacatgttttatcc
G3WSP8_BCL2A1-04      tttgaggatggcatcatcaactggggacggattgtcaccatattt--gct
G3WSP8_BCL2A1-02      tttgaggatggcatcatcaactggggacggattgtcaccatattt--gct
G3WSP8_BCL2A1-03      tttgaggatggcatcatcaactggggacggattgtcaccatattt--gct
                      *** *  * ****                       * *** ***   * 

G3WSP8_BCL2A1-01      ctcgatacaaattcaat--agtaactacatggatatgg---tcaggttat
G3WSP8_BCL2A1-04      tttgggggaattctcattaagaaacttctgagacacagagctccactgac
G3WSP8_BCL2A1-02      tttgggggaattctcattaagaaacttctgagacacagagctccactgac
G3WSP8_BCL2A1-03      tttgggggaattctcattaagaaacttctgagacacagagctccactgac
                       * *    ** *   **  ** **** *   ** *  *   **   * * 

G3WSP8_BCL2A1-01      tttcagc-----tgaagaaattt----tttcacttcccaaaacatcctgg
G3WSP8_BCL2A1-04      tatggacactcatgaagaaatttctcattttattgctgagttcataatga
G3WSP8_BCL2A1-02      tatggacactcatgaagaaatttctcattttattgctgagttcataatga
G3WSP8_BCL2A1-03      tatggacactcatgaagaaatttctcattttattgctgagttcataatga
                      * *   *     ***********    *** * * *  *   ***  ** 

G3WSP8_BCL2A1-01      aacattcatcagcctggtgatgatgaagtacgggagg-------------
G3WSP8_BCL2A1-04      acaacatagcagaatggataagacaaaatggaggat--------------
G3WSP8_BCL2A1-02      acaacatagcagaatggataagacaaaatggaggatgggtgattgctcac
G3WSP8_BCL2A1-03      acaacatagcagaatggataagacaaaatggaggatg-------------
                      *  *   * ***  ***  * **  ** *   ***               

G3WSP8_BCL2A1-01      --------------------------------------------------
G3WSP8_BCL2A1-04      --------------------------------------------------
G3WSP8_BCL2A1-02      agtaaatatcaagagtctcagagaatttcaatctttctaagcatgcagga
G3WSP8_BCL2A1-03      --------------------------------------------------
                                                                        

G3WSP8_BCL2A1-01      --------------------------------------------------
G3WSP8_BCL2A1-04      --------------------------------------------------
G3WSP8_BCL2A1-02      tgaaattgagacagaagaaattatcaaggatatttttaaacaaggcaaaa
G3WSP8_BCL2A1-03      --------------------------------------------------
                                                                        

G3WSP8_BCL2A1-01      --------------------------------------------------
G3WSP8_BCL2A1-04      --------------------------------------------------
G3WSP8_BCL2A1-02      catgttttatccctcgatacaaattcaatagtaactacatggatatggtc
G3WSP8_BCL2A1-03      --------------------------------------------------
                                                                        

G3WSP8_BCL2A1-01      --------------------------------------------------
G3WSP8_BCL2A1-04      --------------------------------------------------
G3WSP8_BCL2A1-02      aggttattttcagctgaagaaattttttcacttcccaaaacatcctggaa
G3WSP8_BCL2A1-03      --------------------------------------------------
                                                                        

G3WSP8_BCL2A1-01      -----------------------------------aggctttgtctaccg
G3WSP8_BCL2A1-04      -------------------------------------------------g
G3WSP8_BCL2A1-02      cattcatcagcctggtgatgatgaagtacgggaggaggctttgtctaccg
G3WSP8_BCL2A1-03      -------------------------------------------------g
                                                                       *

G3WSP8_BCL2A1-01      ggggtctggatctcatcttcatgccaggtcttggatttgaccaacaggga
G3WSP8_BCL2A1-04      ggaaaatgg-------cttcataaagaactttgaac----ccaatatggt
G3WSP8_BCL2A1-02      ggggtctggatctcatcttcatgccaggtcttggatttgaccaacaggga
G3WSP8_BCL2A1-03      ggggtctggatctcatcttcatgccaggtcttggatttgaccaacaggga
                      **    ***       ******        *** *     **** * ** 

G3WSP8_BCL2A1-01      aaccgcctgggaagggggaagggatactatgacacttacctgaagagatg
G3WSP8_BCL2A1-04      a------tggccaaacttcacagatatttcaacaaagatctgg-------
G3WSP8_BCL2A1-02      aaccgcctgggaagggggaagggatactatgacacttacctgaagagatg
G3WSP8_BCL2A1-03      aaccgcctgggaagggggaagggatactatgacacttacctga-------
                      *      ***  *      *  **** *   ***   * ***        

G3WSP8_BCL2A1-01      cttccaacaccaaaaaagaagaccttacacaattgctttggctttcaaag
G3WSP8_BCL2A1-04      ------------------------------aatgtattttcctttctg--
G3WSP8_BCL2A1-02      cttccaacaccaaaaaagaagaccttacacaattgctttggctttcaaag
G3WSP8_BCL2A1-03      --------------------------------------------------
                                                                        

G3WSP8_BCL2A1-01      agcagatctgtgatgcagtgccagtgggagaagatgatatgagaatagat
G3WSP8_BCL2A1-04      --------------------------------------------------
G3WSP8_BCL2A1-02      agcagatctgtgatgcagtgccagtgggagaagatgatatgagaatagat
G3WSP8_BCL2A1-03      --------------------------------------------------
                                                                        

G3WSP8_BCL2A1-01      gaagtgctctatgaagacaaataa
G3WSP8_BCL2A1-04      ------------------aagtaa
G3WSP8_BCL2A1-02      gaagtgctctatgaagacaaataa
G3WSP8_BCL2A1-03      ------------------------
                                              

© 1998-2021Legal notice