Dataset for CDS BCL2A1 of organism Cyanistes caeruleus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A8C0UPM3_BCL2A1-      atg----ctgggggtgccttttgctt-------tcaaagaaggaagagca
A0A8C0UPM3_BCL2A1-      atggaaactgctgagttctattacgtttattacttagctcaggattatct
                        ***    ***  *    ** ** * *       * *    ****  * * 

A0A8C0UPM3_BCL2A1-      gtgaaaagagagtatgtgctccaggaatcacagctcggaccagcccagac
A0A8C0UPM3_BCL2A1-      gc--------agtatgtgctccaggaatcacagctcggaccagcccagac
                        *         ****************************************

A0A8C0UPM3_BCL2A1-      cagggttgctcatgtcttgcgaaccattgcatcttccctgcaagaccaaa
A0A8C0UPM3_BCL2A1-      cagggttgctcatgtcttgcgaaccattgcatcttccctgcaagaccaaa

A0A8C0UPM3_BCL2A1-      ccgaggaggctctcaggccactcctggacaggattgacatcacctctgta
A0A8C0UPM3_BCL2A1-      ccgaggaggctctcaggccactcctggacaggattgacatcacctctgta

A0A8C0UPM3_BCL2A1-      gctgttgccaagagaattttcaatggagtcatggatgaaaagtttgctga
A0A8C0UPM3_BCL2A1-      gctgttgccaagagaattttcaatggagtcatggatgaaaagtttgctga

A0A8C0UPM3_BCL2A1-      tggaaatactaactggggacgaattatgaccatatttacatttggaggtc
A0A8C0UPM3_BCL2A1-      tggaaatactaactggggacgaattatgaccatatttacatttggaggtc

A0A8C0UPM3_BCL2A1-      ttctcaccaagaagcttcaagagcatggagttcagctgactgcagaggag
A0A8C0UPM3_BCL2A1-      ttctcaccaagaagcttcaagagcatggagttcagctgactgcagaggag

A0A8C0UPM3_BCL2A1-      aaggaggagatctcttatttcatcacagagtacatcataaacaacaaagc
A0A8C0UPM3_BCL2A1-      aaggaggagatctcttatttcatcacagagtacatcataaacaacaaagc

A0A8C0UPM3_BCL2A1-      tgaatggattgatgcaaatggtggctgggaaaatggcttcctaacaaagt
A0A8C0UPM3_BCL2A1-      tgaatggattgatgcaaatggtggctgggaaaatggcttcctaacaaagt

A0A8C0UPM3_BCL2A1-      ttgaaagaagatcactactgtctttctccaaaattacagccctgctcata
A0A8C0UPM3_BCL2A1-      ttgaaagaagatcactactgtctttctccaaaattacagccctgctcata

A0A8C0UPM3_BCL2A1-      gctgttgtttccttgttcagagagtactactga
A0A8C0UPM3_BCL2A1-      gctgttgtttccttgttcagagagtactactga

© 1998-2023Legal notice