Dataset for CDS MCL-1 of organism Rhinolophus ferrumequinum

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A671G0G2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Rhinolophus ferrumequinum GN=MCL-1 (length=1044 residues).
atgctgggcctcaaaagaaacgcagtaatcggactcaacctctactgtggggggtccgggttaggggccggcagcggcgg
cagcgcctccccttcgggagagcggcttctggccgcggggaaggaggccaccgcccggcgagaggcagggggaggggaag
ccggtgcggtgattggcggaagcgccggcgcgagccccccggccactctcgcgccggacgcccggagggtcgcgcggccc
tcgcccattggcgccgagagccccgacgtcacggcgacccccgcgaggcggctgttcttcgcgccctccttccgcgcgtc
gccgcttaaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggaactggacgggtacgagccggagc
ctctcgggaagcggccggctgtcctgcccttgctagagcgggtcgaggaggccagtaatggacccggtatgagcggctca
ctgccctctacgccgccccccgcagaggaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggta
ccttcgggagcaggcgaccggcgccaaggacgcgaagccaatgggcaggtctgcgtccgccagccgcaaggcgttagaca
cccttcggcgggttggggacggtgtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaa
aacgaagacgacgtcaaatctttgtctcgagtgatgattcacgtttttagtgacggagtaacaaactggggcaggattgt
gactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcag
aaagcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctggagaatgccagcaagacaa
gtgcacttcgaagcagaggagcaggacacaggaccaaaatcctggcccaagttgagttctgagcagtactgttgctcctg
ttga
>gnl|bcl2dbcds|A0A671G0G2_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Rhinolophus ferrumequinum GN=MCL-1 (length=1059 residues).
atgctgggcctcaaaagaaacgcagtaatcggactcaacctctactgtggggggtccgggttaggggccggcagcggcgg
cagcgcctccccttcgggagagcggcttctggccgcggggaaggaggccaccgcccggcgagaggcagggggaggggaag
ccggtgcggtgattggcggaagcgccggcgcgagccccccggccactctcgcgccggacgcccggagggtcgcgcggccc
tcgcccattggcgccgagagccccgacgtcacggcgacccccgcgaggcggctgttcttcgcgccctccttccgcgcgtc
gccgcttaaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggaactggacgggtacgagccggagc
ctctcgggaagcggccggctgtcctgcccttgctagagcgggtcgaggaggccagtaatggacccggtatgagcggctca
ctgccctctacgccgccccccgcagaggaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggta
ccttcgggagcaggcgaccggcgccaaggacgcgaagccaatgggcaggtctgcgtccgccagccgcaaggcgttagaca
cccttcggcgggttggggacggtgtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaa
aacgaagacgacgtcaaatctttgtctcgagtgatgattcacgtttttagtgacggagtaacaaactggggcaggattgt
gactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcag
aaagcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttc
ttccacgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtcggagctggtct
ggcatatctaataagatag
>gnl|bcl2dbcds|A0A671G0G2_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Rhinolophus ferrumequinum GN=MCL-1 (length=597 residues).
atgctgggcctcaaaagaaacgcagtaatcggactcaacctctactgtggggggtccgggttaggggccggcagcggcgg
cagcgcctccccttcgggagagcggcttctggcgaccggcgccaaggacgcgaagccaatgggcaggtctgcgtccgcca
gccgcaaggcgttagacacccttcggcgggttggggacggtgtgcagcgcaaccacgagacggctttccaaggcatgctt
cggaaactggacatcaaaaacgaagacgacgtcaaatctttgtctcgagtgatgattcacgtttttagtgacggagtaac
aaactggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagct
gcatcgaaccattagcagaaagcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgg
gatgggtttgtggagttcttccacgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgc
tggagtcggagctggtctggcatatctaataagatag
© 1998-2020Legal notice