Dataset for CDS Unclassified of organism Erpetoichthys calabaricus

[Download (right click)]

4 sequence(s)

>gnl|bcl2dbcds|A0A8C4RXD1_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Erpetoichthys calabaricus (length=705 residues).
atggcgagtaacagggttccctatgacaactggaatatcgtgtctttctacatccgtgagcggctccttcgaatgggtta
cgagtgggaagcccatgtgctcagggagcgcgattctcccaataatggttcgctcggctcctcccactcacctcagcagc
ccccaaggagagcgggcgttttacagatccgcccaggggatccccacaccgctatacatggggtgctccgggatgccggg
gacgagatctcccgacggtaccaacgggatttcgcggagatgtccggccagctgcaccttaccccgagcactgcccggag
aaaattcgccgccgtggctgaggaactgttccgggatggtgtgaactggggtcgcattgtggcttttttcgaatttggag
gtaccatgtgcgtggaaagcgtcaatcgggaaatgacctcacaagtggaccatatcgctgactggatgacggactatctg
aacggaccccttcacaactggatccaagacaacggtggatggttccctgcagaccgttcccaggaaatcccgccaggtgc
cgaagctcagaagaagacacttccggtcccatccccgagggcgacatcacttccgtcaactctccataaaagctgctccc
cttcctgtggtgatcagttctgtcttggactcagtagtataaactacccagtgctaactttttga
>gnl|bcl2dbcds|A0A8C4SVH9_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Erpetoichthys calabaricus (length=756 residues).
atgtcttacttttcgaaaagcacgcaaacgatgtcaaggaggcttgaggatggcaagtttgacgataatttggaagaggc
ggattcggtctcacagcttcagaagttatcgtcgaagaattgcttggaattgggcgagggcgccaatgtggacagctgtc
gtccatctacacgggatgcgacttcaagacccgtggacagcgttcagtgtggacccaggcctgttccccgattagagaag
gaaacccgggagctgattgcggcttacttattccgatcagccggattgccccactcatgtagccgctctggaagaaaacc
ttatgacatccttgttcttgctggggatcgaataatcgaaaacaacaaatcatggtttaacgagcttctggaaagtatcg
atgtctcccagaaggaactccctgagtatgtgaccactcttgctcaagttacgctcaccgggagagaaatgaaatggaga
tatgttctgggcttcataatacatgggtcagttgtagccaagcgcctaaagcaagtcaaccaggagcattgcatcctgcc
cttggcagacctcatgtctgccttactgcttaaacattgtaaggattggattgtgaaaaatagagcttgggaaggctttt
cagactattatcactttctcgtccgtgaaccagaaacatggcagttcccactcacctgtttaggattgtcgtttcttgca
gctctccttgtttgtttgtttgaggagttaatgtga
>gnl|bcl2dbcds|A0A8C4SXC2_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Erpetoichthys calabaricus (length=753 residues).
atgtcttacttttcgaaaagcacgcaaacgatgtcaaggaggcttgaggatggcaagtttgacgataatttggaagaggc
ggattcggtctcacagcttcagaagttatcgtcgaagaattgcttggaattgggcgagggcgccaatgtggacagctgtc
gtccatctacacgggatgcgacttcaagacccgtggacagcgttcagtatggacccaggcctgtttcccgattagagaag
gaaacccgggagctgattgcggcttacttatttcgatcagccggattgccccactcatgtagccgctctggaagaaaacc
tttcgacatccttgttcgtgctgaggatcgtttaatcgaaaccaacagatcatggtttaacgaagctgtgcagacaattg
atgtctcccagaaggaagtccttgagaacacgaccggtgttgctcaagccatgctcacccagaaagtaatgaaatggaga
tatgttctgagcttcatgatgtatgggtcagttgtagccaagcacctaaaggaagtcaaccaggagcattgcatcctgcc
cttggcagacctcatgtctgccttactgcttaaacattgtaaggattggattgtgaaaaatagagcttgggaaggctttt
cagactattatcactttctcgtccgtgatcaagaaacatggcagttcccactcacctgtttaggattgtcgtttcttgca
gctctccttgtttgtttgtttgagttaatgtga
>gnl|bcl2dbcds|A0A8C4T7P8_uncBCL2A1-01 Putative BCL2-related protein A1 gene OS=[Eukaryota] Erpetoichthys calabaricus (length=528 residues).
atgccctgttataggaaggaaacatacgaagttgcaaagggttatattgaccactgcataggagttcaaagggcacctcc
cagcgaaacagtccaaataatgtgcagccttgctaaagaaatggagaagacctaccagcacaagttgaactccttgctgc
agaactttatttcctgttgtaccccagattatggtgtgaagctcaagagagtaatggaagaaatggtaggagatgggata
ttaaactggggccgtattgttagcctcttcacctttacgggattgctggcccaggaactccattcaaaaggagctggaac
ggactgcagtaacaagttggcagatacgattgctgattacctgggggttgaaaaggcagagtggctggctcaaaatggag
gctgggatggatttagcaagtatttccaaaactccaaggattcccattcagattcttccatgaagacggcattgtttgca
gcagctggctttggaattgcaggcctagccatcctccttgtgcgatag
© 1998-2022Legal notice