Dataset for CDS BAX of Organism Astyanax mexicanus

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3B1J1X1_BAX-02      atggcagattccggagacagcggagggaatgaggacagtgagctgttagg
A0A3B1J1X1_BAX-01      atggcagattccggagacagcggagggaatgaggacagtgagctgttagg
A0A8B9LSU6_BAX-01      atggcagattccggagacagcggggggaatgaggacagtgagctgttagg
A0A3B1JGN3_BAX-01      atg---------------------------------------------gc
A0A8B9JV42_BAX-01      atg---------------------------------------------gc
W5KCK0_BAX-01          atgtt---------------------------------tgtatgttctgt
A0A8B9JV95_BAX-01      atgac---------------------------------tgacctctgggt
A0A8B9JV95_BAX-02      ------------------------------------------------at
                                                                         

A0A3B1J1X1_BAX-02      agctacaggtggagaagatgttgtagacgaccaaatcgtagaacaaggcg
A0A3B1J1X1_BAX-01      agctacaggtggagaagatgttgtagacgaccaaatcgtagaacaaggcg
A0A8B9LSU6_BAX-01      agctacaggtggagaagatgttgtagacgaccaaatcgtagaacaaggcg
A0A3B1JGN3_BAX-01      agctcagggagaaggttatgctgttaatctgctacgcataggatatagg-
A0A8B9JV42_BAX-01      agctcagggagaaggttatgctgttaatctgctacgcataggatatagg-
W5KCK0_BAX-01          gttcaaaggcaacggtaa---tgaacaactgttagacctgggagcttcc-
A0A8B9JV95_BAX-01      -------------ggcag---tgtgcagtagtta-----------cagt-
A0A8B9JV95_BAX-02      -------------ggca---------------ta-----------tgtt-
                                    *                   *                

A0A3B1J1X1_BAX-02      cattagtactgagagggtatgttcttcggcggctc---agtacagagaac
A0A3B1J1X1_BAX-01      cattagtactgagagggtatgttcttcggcggctc---agtacagagaac
A0A8B9LSU6_BAX-01      caatagtactgagagggtatgttcttcggcggctc---agtacagagaac
A0A3B1JGN3_BAX-01      -----ctactgataaactttatctctgagcgtcttcagcgcacattggaa
A0A8B9JV42_BAX-01      -----ctactgataaactttatctctgagcgtcttcagcgcacattggaa
W5KCK0_BAX-01          -----ctgctaaaagattttatctaccaacgggttcagcgtcatggggac
A0A8B9JV95_BAX-01      -----ctgtttctatcttttctttcctc----------------------
A0A8B9JV95_BAX-02      -----ctgtttctatcttttctttcctc----------------------
                             *  *   *   * * *                            

A0A3B1J1X1_BAX-02      cctgatgtacgtgtgagtcgggtggaccttggtggaagacctgatgaagg
A0A3B1J1X1_BAX-01      cctgatgtacgtgtgagtcgggtggaccttggtggaagacctgatgaagg
A0A8B9LSU6_BAX-01      cctgatgtacgtgtgagttgggtggaccttggtggaagacctgatgaagg
A0A3B1JGN3_BAX-01      attgatgctgcagtaaccaaa----aacctgttggacgagacggaagagg
A0A8B9JV42_BAX-01      attgatgctgcagtaaccaaa----aacctgttggacgagacggaagagg
W5KCK0_BAX-01          agcaatgctttggtgacaagg----aaccagttgggcgggac---agagt
A0A8B9JV95_BAX-01      --------------------------------------------------
A0A8B9JV95_BAX-02      --------------------------------------------------
                                                                         

A0A3B1J1X1_BAX-02      cg-atgaccctcagataaaagtggttgtggagcagcttcttagaattgct
A0A3B1J1X1_BAX-01      cg-atgaccctcagataaaagtggttgtggagcagcttcttagaattgct
A0A8B9LSU6_BAX-01      cg-atgaccctcaaataaaagtggttgtggagcagcttcttagaattgct
A0A3B1JGN3_BAX-01      tgcctgatcccaacattaagaaagttggacagcgtctacagcagtttgga
A0A8B9JV42_BAX-01      tgcctgatcccaacattaagaaagttggacagcgtctacagcagtttgga
W5KCK0_BAX-01          tgtgtgacccgagccataagagacttgcgcagtgtcttcagcagattgga
A0A8B9JV95_BAX-01      --------------------------------tgtc--------------
A0A8B9JV95_BAX-02      --------------------------------tgtc--------------
                                                          *              

A0A3B1J1X1_BAX-02      gatgatctgaatcgcaatactgagcttcaacacctcatcagcact-----
A0A3B1J1X1_BAX-01      gatgatctgaatcgcaatactgagcttcaacacctcatcagcact-----
A0A8B9LSU6_BAX-01      gatgatctgaatcgcaatactgagcttcaacacctcatcagcact-----
A0A3B1JGN3_BAX-01      gatgaactggacaatgacacaaaattgaaagagatgattaataac-----
A0A8B9JV42_BAX-01      gatgaactggacaatgacacagaattgaaaaagatgattaataac-----
W5KCK0_BAX-01          gacgagttagacagcaatgtacagctgcagagtatgataaatgactcggc
A0A8B9JV95_BAX-01      ------------------------------agtatgataaatgactcggc
A0A8B9JV95_BAX-02      ------------------------------agtatgataaatgactcggc
                                                         * ** *          

A0A3B1J1X1_BAX-02      -gtgcaggctaactgtgctcaggatgtgtttatgacggtggccaggacga
A0A3B1J1X1_BAX-01      -gtgcaggctaactgtgctcaggatgtgtttatgacggtggccaggacga
A0A8B9LSU6_BAX-01      -gtgcaggctaactgtgctcaggatgtgttcatgacggtggccaggacga
A0A3B1JGN3_BAX-01      -ctaatgccca------caaaagaagtgttcctgaaaatcgcctatgaaa
A0A8B9JV42_BAX-01      -ctaatgccca------caaaagaagtgttcctgaaaatcgcctatgaaa
W5KCK0_BAX-01          gctacagccca------cccaagacgtgtttgtgaaagtggcttgtgaaa
A0A8B9JV95_BAX-01      gctacagccca------cccaagacgtgtttgtgaaagtggcttgtgaaa
A0A8B9JV95_BAX-02      gctacagccca------cccaagacgtgtttgtgaaagtggcttgtgaaa
                         *   * * *      *  * ** *****  ***   * **       *

A0A3B1J1X1_BAX-02      tcttcacagatggca---ttaactggggacgaatcgtggctctgtttcat
A0A3B1J1X1_BAX-01      tcttcacagatggca---ttaactggggacgaatcgtggctctgtttcat
A0A8B9LSU6_BAX-01      tcttcacagatggca---ttaactggggacgaatcgtggctctgtttcat
A0A3B1JGN3_BAX-01      tcttctctgactggaagtttaactggggcagggtggtggcactgttctac
A0A8B9JV42_BAX-01      tcttctctgactggaagtttaactggggcagggtggtggcactgttctac
W5KCK0_BAX-01          tcttctctgatgggaagtttaactggggcagggtggtggcgcttttctat
A0A8B9JV95_BAX-01      tcttctctgatgggaagtttaactggggcagggtggtggcgcttttctat
A0A8B9JV95_BAX-02      tcttctctgatgggaagtttaactggggcagggtggtggcgcttttctat
                       ***** * **  * *   **********  *  * ***** ** **  * 

A0A3B1J1X1_BAX-02      ctggcctatcagcttatttataatactttgagagaggaaactataatgtc
A0A3B1J1X1_BAX-01      ctggcctatcagcttatttataatgcactgactca--aaaccacttag--
A0A8B9LSU6_BAX-01      ctggcctatcagcttatttataatgcactgactca--aaaccacttag--
A0A3B1JGN3_BAX-01      tttgcttgtgagtttgtcaagatgg-----------------ttcctg--
A0A8B9JV42_BAX-01      tttgcttgtgagtttgtcaagatgg-----------------ttcctg--
W5KCK0_BAX-01          tttgcttgtcgactcgtcatcaaggctgtgctgac--taagcttcctg--
A0A8B9JV95_BAX-01      tttgcttgtcgactcgtcatcaaggctgtgctgac--taagcttcctg--
A0A8B9JV95_BAX-02      tttgcttgtcgactcgtcatcaaggctgtgctgac--taagcttcctg--
                        * ** * *    *  *    *                         *  

A0A3B1J1X1_BAX-02      aaatcaacaaacgctttcaaatcttcctcggg---------------agt
A0A3B1J1X1_BAX-01      aaatcatcaagaac------atcattagctgggtattacagtatatcagg
A0A8B9LSU6_BAX-01      aaatcatcaataac------atcattagctgggtattacagtatatcagg
A0A3B1JGN3_BAX-01      atatcatcagtaac------atcatcagctggactctagaattcatgcgt
A0A8B9JV42_BAX-01      atatcatcagtaac------atcatcagctggactctagaattcatgcgt
W5KCK0_BAX-01          acatcatcagaacc------atcatcaattggaccgtagactacctgcgg
A0A8B9JV95_BAX-01      acatcatcagaacc------atcatcaattggaccgtagactacctgcgg
A0A8B9JV95_BAX-02      acatcatcagaacc------atcatcaattggaccgtagactacctgcgg
                       * **** **    *      *** *     **                * 

A0A3B1J1X1_BAX-02      tggtacgtacagctgtggtggagattgtaagtacgactaga------ttt
A0A3B1J1X1_BAX-01      cagcacgtatccgcctggatcagacagcagggaggatgggaaggggttat
A0A8B9LSU6_BAX-01      cagcacgtatccgcctggatcagacagcagggaggatgggaaggggttat
A0A3B1JGN3_BAX-01      gatcatgtgattgcatggatcagtggacagggaggctgggacgcaat--c
A0A8B9JV42_BAX-01      gatcatgtgattgcatggatcagtggacagggaggctgggacgcaat--c
W5KCK0_BAX-01          gaacatgtgattaattggatcagggaacagggaggctgggaaggtat--c
A0A8B9JV95_BAX-01      gaacatgtgattaattggatcagggaacagggaggctgggaaggtat--c
A0A8B9JV95_BAX-02      gaacatgtgattaattggatcagggaacagggaggctgggaaggtat--c
                           * **       ***   **     * * * *    **         

A0A3B1J1X1_BAX-02      ctgttttggttccaaa-------------catcattaac----tccctgg
A0A3B1J1X1_BAX-01      ccgcagcgtgtcgaga--------tggcgcaccgtgaccgtgatcgctgc
A0A8B9LSU6_BAX-01      ccgcagcgtgtcgaga--------tggcgcaccgtgaccgtgatcgctgc
A0A3B1JGN3_BAX-01      ctctcacagattgaagcaccttcctggacaactgtcactgcatttgtggc
A0A8B9JV42_BAX-01      ctctcacagattgaagcaccttcctggacaactgtcactgcatttgtggc
W5KCK0_BAX-01          cggtcctactttggaacccctacctggcaaactgttggcgtctttctggc
A0A8B9JV95_BAX-01      cggtcctactttggaacccctacctggcaaactgttggcgtctttctggc
A0A8B9JV95_BAX-02      cggtcctactttggaacccctacctggcaaactgttggcgtctttctggc
                       *         *                   *   *        *    * 

A0A3B1J1X1_BAX-02      ggaaaatgctttctatgtttacttctgtttttttctgaggctaaa-----
A0A3B1J1X1_BAX-01      agta---gcattc----atcgctgctgctgtatactggaaacgaagtcgc
A0A8B9LSU6_BAX-01      tgta---gcattc----atcgctgctgctgtatactggaaacgaagtcgc
A0A3B1JGN3_BAX-01      tgga---gttctc-------actactgctctcatcgtaaacaaaatg---
A0A8B9JV42_BAX-01      tgga---gttctc-------actactgctctcatcgtaaacaaaatg---
W5KCK0_BAX-01          tgga---gtgctc-------accactgtgctggtcatgcgcaaaatg---
A0A8B9JV95_BAX-01      tgga---gtgctc-------accactgtgctggtcatgcgcaaaatg---
A0A8B9JV95_BAX-02      tgga---gtgctc-------accactgtgctggtcatgcgcaaaatg---
                        * *   *   **        *  ***   *   *        **     

A0A3B1J1X1_BAX-02      tga
A0A3B1J1X1_BAX-01      tga
A0A8B9LSU6_BAX-01      tga
A0A3B1JGN3_BAX-01      tga
A0A8B9JV42_BAX-01      tga
W5KCK0_BAX-01          tga
A0A8B9JV95_BAX-01      tga
A0A8B9JV95_BAX-02      tga
                       ***

© 1998-2023Legal notice