Dataset for CDS BCL-2 of organism Panthera tigris altaica

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C9J3W6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Panthera tigris altaica GN=BCL-2 (length=498 residues).
atggcgcacgctgggagaacagggtatgacaaccgggagatagtcatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggggacgcgagnnnnnnnnnnnnnnnnnnnnnnnnnnnngccgccgccgccgcgggccctgcgc
tcagccctgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgcgacttc
gcggagatgtccagccagctgcacctgacaccctttaccgcaaggggacgctttgccacggtggtggaggagctcttcag
ggatggagtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgagaga
tgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctggatccaagacaac
ggaggctgggtaggtgca
© 1998-2022Legal notice