Dataset for CDS BOK of Organism Astatotilapia calliptera

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3P8R8S7_BOK-01      atggagatgttgcgtcgctcctctgtgtttgc---------ctctgaagt
A0A3P8R188_BOK-01      atggaggtcctgcgcaggtcttcagtgtttgctgcagaggtcctggatgt
A0A3P8R188_BOK-02      atggaggtcctgcgcaggtcttcagtgtttgctgcagaggtcctggatgt
A0A3P8R188_BOK-03      atggaggtcctgcgcaggtcttcagtgtttgctgcagaggtcctggatgt
A0A3P8R188_BOK-05      atggaggtcctgcgcaggtcttcagtgtttgctgcagaggtcctggatgt
A0A3P8R188_BOK-06      atggaggtcctgcgcaggtcttcagtgtttgctgcagaggtcctggatgt
A0A3P8R188_BOK-04      atggaggtcctgcgcaggtcttcagtgtttgctgcagaggtcctggatgt
                       ****** *  ****  * ** ** ********         *   ** **

A0A3P8R8S7_BOK-01      gtttgaccgctcgcccaccgacaaggagctggtgtcccaagccaaagcac
A0A3P8R188_BOK-01      gtttgaccgatcactgaccgagaaggagctggtgacccagtctaaggcgc
A0A3P8R188_BOK-02      gtttgaccgatcactgaccgagaaggagctggtgacccagtctaaggcgc
A0A3P8R188_BOK-03      gtttgaccgatcactgaccgagaaggagctggtgacccagtctaaggcgc
A0A3P8R188_BOK-05      gtttgaccgatcactgaccgagaaggagctggtgacccagtctaaggcgc
A0A3P8R188_BOK-06      gtttgaccgatcactgaccgagaaggagctggtgacccagtctaaggcgc
A0A3P8R188_BOK-04      gtttgaccgatcactgaccgagaaggagctggtgacccagtctaaggcgc
                       ********* ** *  ***** ************ ****  * ** ** *

A0A3P8R8S7_BOK-01      tgtgcagggaatacatccactccaggctgaaccgtgccgggatcggctgg
A0A3P8R188_BOK-01      tgtgcagagactacatcttgtcgaggctcaaccaaaacgggttgggatgg
A0A3P8R188_BOK-02      tgtgcagagactacatcttgtcgaggctcaaccaaaacgggttgggatgg
A0A3P8R188_BOK-03      tgtgcagagactacatcttgtcgaggctcaaccaaaacgggttgggatgg
A0A3P8R188_BOK-05      tgtgcagagactacatcttgtcgaggctcaaccaaaacgggttgggatgg
A0A3P8R188_BOK-06      tgtgcagagactacatcttgtcgaggctcaaccaaaacgggttgggatgg
A0A3P8R188_BOK-04      tgtgcagagactacatcttgtcgaggctcaaccaaaacgggttgggatgg
                       ******* ** ******   ** ***** ****    **** * ** ***

A0A3P8R8S7_BOK-01      tccaagcctgaacacggactggctgcgtcaggtgggacactgggagagat
A0A3P8R188_BOK-01      tctaaaactgaactcaatttttctccctcaaacacagcgctggctgaagt
A0A3P8R188_BOK-02      tctaaaactgaactcaatttttctccctcaaacacagcgctggctgaagt
A0A3P8R188_BOK-03      tctaaaactgaactcaatttttctccctcaaacacagcgctggctgaagt
A0A3P8R188_BOK-05      tctaaaactgaactcaatttttctccctcaaacacagcgctggctgaagt
A0A3P8R188_BOK-06      tctaaaactgaactcaatttttctccctcaaacacagcgctggctgaagt
A0A3P8R188_BOK-04      tctaaaactgaactcaatttttctccctcaaacacagcgctggctgaagt
                       ** **  ****** *    *  ** * ***       * ****  **  *

A0A3P8R8S7_BOK-01      atcttcggtcctgctgtggctgggcgatgagttggagtaccttcgtccca
A0A3P8R188_BOK-01      gtctatggtgcttctctgtcttggcgatgagctggagtgtatacagccca
A0A3P8R188_BOK-02      gtctatggtgcttctctgtcttggcgatgagctggagtgtatacagccca
A0A3P8R188_BOK-03      gtctatggtgcttctctgtcttggcgatgagctggagtgtatacagccca
A0A3P8R188_BOK-05      gtctatggtgcttctctgtcttggcgatgagctggagtgtatacagccca
A0A3P8R188_BOK-06      gtctatggtgcttctctgtcttggcgatgagctggagtgtatacagccca
A0A3P8R188_BOK-04      gtctatggtgcttctctgtcttggcgatgagctggagtgtatacagccca
                        ***  *** ** ** ** ** ********* ******   * *  ****

A0A3P8R8S7_BOK-01      atgtgtaccgtaacgtcgcccgccagctgaacatcacagtggcatcggag
A0A3P8R188_BOK-01      gtttgtacaggaacgtggcgcggcagctcaacatttctgttgccatggag
A0A3P8R188_BOK-02      gtttgtacaggaacgtggcgcggcagctcaacatttctgttgccatggag
A0A3P8R188_BOK-03      gtttgtacaggaacgtggcgcggcagctcaacatttctgttgccatggag
A0A3P8R188_BOK-05      gtttgtacaggaacgtggcgcggcagctcaacatttctgttgccatggag
A0A3P8R188_BOK-06      gtttgtacaggaacgtggcgcggcagctcaacatttctgttgccatggag
A0A3P8R188_BOK-04      gtttgtacaggaacgtggcgcggcagctcaacatttctgttgccatggag
                        * ***** * ***** ** ** ***** *****  * ** **   ****

A0A3P8R8S7_BOK-01      agcgtggtgtccgacgccttcctggctgtcgctgcagacattttctccac
A0A3P8R188_BOK-01      aacatggtttcggatgccttcatcggtgtagcaacagagattttctcagc
A0A3P8R188_BOK-02      aacatggtttcggatgccttcatcggtgtagcaacagagattttctcagc
A0A3P8R188_BOK-03      aacatggtttcggatgccttcatcggtgtagcaacagagattttctcagc
A0A3P8R188_BOK-05      aacatggtttcggatgccttcatcggtgtagcaacagagattttctcagc
A0A3P8R188_BOK-06      aacatggtttcggatgccttcatcggtgtagcaacagagattttctcagc
A0A3P8R188_BOK-04      aacatggtttcggatgccttcatcggtgtagcaacagagattttctcagc
                       * * **** ** ** ****** * * *** **  **** ********  *

A0A3P8R8S7_BOK-01      aggtgtgacatggggaaaggtggtttccttgtacgctgtagcgggagcct
A0A3P8R188_BOK-01      aggcataacatggggtaaggtggtgtccatgtttgcggtagctggagccc
A0A3P8R188_BOK-02      aggcataacatggggtaaggtggtgtccatgtttgcggtagctggagccc
A0A3P8R188_BOK-03      aggcataacatggggtaaggtggtgtccatgtttgcggtagctggagccc
A0A3P8R188_BOK-05      aggcataacatggggtaaggtggtgtccatgtttgcggtagctggagccc
A0A3P8R188_BOK-06      aggcataacatggggtaaggtggtgtccatgtttgcggtagctggagccc
A0A3P8R188_BOK-04      aggcataacatggggtaaggtggtgtccatgtttgcggtagctggagccc
                       ***  * ******** ******** *** ***  ** ***** ****** 

A0A3P8R8S7_BOK-01      tggcggtggactgtgtacgccatggtcatccagcaatggtccataccatt
A0A3P8R188_BOK-01      tggcagtggactgtgtcagacaaggccatccggctacagtgcacatctta
A0A3P8R188_BOK-02      tggcagtggactgtgtcagacaaggccatccggctacagtgcacatctta
A0A3P8R188_BOK-03      tggcagtggactgtgtcagacaaggccatccggctacagtgcacatctta
A0A3P8R188_BOK-05      tggcagtggactgtgtcagacaaggccatccggctacagtgcacatctta
A0A3P8R188_BOK-06      tggcagtggactgtgtcagacaaggccatccggctacagtgcacatctta
A0A3P8R188_BOK-04      tggcagtggactgtgtcagacaaggccatccggctacagtgcacatctta
                       **** ***********  * ** ** ***** ** *  ** ** * * * 

A0A3P8R8S7_BOK-01      gtcgactgcatgggggagtttgtccgcaagagcctgacttcctggttaaa
A0A3P8R188_BOK-01      gtggacagtctgggacagtttgtccgcaaattcctggttccctggctgaa
A0A3P8R188_BOK-02      gtggacagtctgggacagtttgtccgcaaattcctggttccctggctgaa
A0A3P8R188_BOK-03      gtggacagtctgggacagtttgtccgcaaattcctggttccctggctgaa
A0A3P8R188_BOK-05      gtggacagtctgggacagtttgtccgcaaattcctggttccctggctgaa
A0A3P8R188_BOK-06      gtggacagtctgggacagtttgtccgcaaattcctggttccctggctgaa
A0A3P8R188_BOK-04      gtggacagtctgggacagtttgtccgcaaattcctggttccctggctgaa
                       ** *** *  ****  *************   ****  * ***** * **

A0A3P8R8S7_BOK-01      aaagagaggaggctgggtggatgt-------aacaaagtgcgtggtgagc
A0A3P8R188_BOK-01      gcgacggggaggatgggtaagtttctgcctcagcaaaattttgggcaaac
A0A3P8R188_BOK-02      gcgacggggaggatgggtaagtttctgcctcagcaaaattttgggcaaac
A0A3P8R188_BOK-03      gcgacggggaggatgggtaagtttctgcctcagcaaaattttgggcaaac
A0A3P8R188_BOK-05      gcgacggggaggatgggtaagtttctgcctcagcaaaattttgggcaaac
A0A3P8R188_BOK-06      gcgacggggaggatgggtaagtttctgcctcagcaaaattttgggcaaac
A0A3P8R188_BOK-04      gcgacggggaggatgggtggagatc-------acaaaatgtgtggtgaaa
                            * ***** *****     *         **** *    **  *  

A0A3P8R8S7_BOK-01      a----------------ctgaccc----------aaacttctgttcgcac
A0A3P8R188_BOK-01      atgaaatgcataaaaagttgacatttgagata--caacagcgatttgcat
A0A3P8R188_BOK-02      atgaaatgcataaaaagttgacatttgagata--caacagcgatttgcat
A0A3P8R188_BOK-03      atgaaatgcataaaaagttgacatttgagata--caacagcgatttgcat
A0A3P8R188_BOK-05      atgaaatgcataaaaagttgacatttgagata--caacagcgatttgcat
A0A3P8R188_BOK-06      atgaaatgcataaaaagttgacatttgagata--caacagcgatttgcat
A0A3P8R188_BOK-04      aaggatt----------tttgccctgaagaaaactggctgtcctctgcct
                       *                 *  *               *     *  **  

A0A3P8R8S7_BOK-01      tggctggtgtctgctgtctgtgcctttggacactacctgaagacggtcgt
A0A3P8R188_BOK-01      ttgctagttttgtgtgtgtgtgtgcaggggtggggtggggatttgaattt
A0A3P8R188_BOK-02      ttgctagttttgtgtgtgtgtgtgcaggggtggggtggggatttgaattt
A0A3P8R188_BOK-03      ttgctagttttgtgtgtgtgtgtgcaggggtggggtggggatttgaattt
A0A3P8R188_BOK-05      ttgctagttttgtgtgtgtgtgtgcaggggtggggtggggatttgaattt
A0A3P8R188_BOK-06      ttgctagttttgtgtgtgtgtgtgcaggggtggggtggggatttgaattt
A0A3P8R188_BOK-04      ttg--agtccctcaagtgcttcctcacga--------------------c
                       * *   **       **   *      *                      

A0A3P8R8S7_BOK-01      gctaca--cctcctccgcg----agaagtga
A0A3P8R188_BOK-01      gatgca---ctgctttgtg-------catga
A0A3P8R188_BOK-02      gatgca---ctgctttgtg-------catga
A0A3P8R188_BOK-03      gatgca---ctgctttgtg-------catga
A0A3P8R188_BOK-05      gatgca---ctgctttgtg-------catga
A0A3P8R188_BOK-06      gatgca---ctgctttgtg-------catga
A0A3P8R188_BOK-04      gatgtatgtctacatcatgaaggagccgtga
                       * *  *   ** *     *         ***

© 1998-2020Legal notice