Dataset for CDS MCL-1 of organism Pongo abelii

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


H2N5Y9_MCL1-01      atgttcggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggc
H2N5Y9_MCL1-02      atgttcggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggc
H2N5Y9_MCL1-03      atgttcggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggc
                    ************************************************************

H2N5Y9_MCL1-01      ttgggtgctggcagcggcggcgccacccctccgggagggcggcttttggctacggagaag
H2N5Y9_MCL1-02      ttgggtgctggcagcggcggcgccacccctccgggagggcggcttttggctacggagaag
H2N5Y9_MCL1-03      ttgggtgctggcagcggcggcgccacccctccgggagggcggctttt-------------
                    ***********************************************             

H2N5Y9_MCL1-01      gaggcctcggcccggcgagagatagggggaggggaggccggcgcggtgattggcggaagc
H2N5Y9_MCL1-02      gaggcctcggcccggcgagagatagggggaggggaggccggcgcggtgattggcggaagc
H2N5Y9_MCL1-03      ------------------------------------------------------------
                                                                                

H2N5Y9_MCL1-01      gccggcgcaagccccccgtctaccctcacgccagactcccggagggtcgcgcggccgccg
H2N5Y9_MCL1-02      gccggcgcaagccccccgtctaccctcacgccagactcccggagggtcgcgcggccgccg
H2N5Y9_MCL1-03      ------------------------------------------------------------
                                                                                

H2N5Y9_MCL1-01      cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgtttttcttcgcg
H2N5Y9_MCL1-02      cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgtttttcttcgcg
H2N5Y9_MCL1-03      ------------------------------------------------------------
                                                                                

H2N5Y9_MCL1-01      cccacccgccgcgcggcgccgcttgaggagatggaagccccggccgccgacgccatcatg
H2N5Y9_MCL1-02      cccacccgccgcgcggcgccgcttgaggagatggaagccccggccgccgacgccatcatg
H2N5Y9_MCL1-03      ------------------------------------------------------------
                                                                                

H2N5Y9_MCL1-01      tcgcccgaagaggagctggacgggtacgagccggagcctctcgggaagcggccggctgtc
H2N5Y9_MCL1-02      tcgcccgaagaggagctggacgggtacgagccggagcctctcgggaagcggccggctgtc
H2N5Y9_MCL1-03      ------------------------------------------------------------
                                                                                

H2N5Y9_MCL1-01      ctgcctctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
H2N5Y9_MCL1-02      ctgcctctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
H2N5Y9_MCL1-03      ------------------------------------------------------------
                                                                                

H2N5Y9_MCL1-01      ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggag
H2N5Y9_MCL1-02      ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggag
H2N5Y9_MCL1-03      ------------------------------------------------------------
                                                                                

H2N5Y9_MCL1-01      attatctctcggtaccttcgggagcaggccaccggcgccaaggacacaaagccattgggc
H2N5Y9_MCL1-02      attatctctcggtaccttcgggagcaggccaccggcgccaaggacacaaagccattgggc
H2N5Y9_MCL1-03      --------------------------ggccaccggcgccaaggacacaaagccattgggc
                                              **********************************

H2N5Y9_MCL1-01      aggtctggggccacctgcaggaaggctctggagaccttacgacgggttggggatggcgtg
H2N5Y9_MCL1-02      aggtctggggccacctgcaggaaggctctggagaccttacgacgggttggggatggcgtg
H2N5Y9_MCL1-03      aggtctggggccacctgcaggaaggctctggagaccttacgacgggttggggatggcgtg
                    ************************************************************

H2N5Y9_MCL1-01      cagcgcaaccacgagacggccttccaa---------------------------------
H2N5Y9_MCL1-02      cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
H2N5Y9_MCL1-03      cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
                    ***************************                                 

H2N5Y9_MCL1-01      ------------------------------------------------------------
H2N5Y9_MCL1-02      gacgatgtgaaatcgttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaac
H2N5Y9_MCL1-03      gacgatgtgaaatcgttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaac
                                                                                

H2N5Y9_MCL1-01      ------------------------------------------------------------
H2N5Y9_MCL1-02      tggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagacc
H2N5Y9_MCL1-03      tggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagacc
                                                                                

H2N5Y9_MCL1-01      ------------------------------------------------------------
H2N5Y9_MCL1-02      ataaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaagg
H2N5Y9_MCL1-03      ataaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaagg
                                                                                

H2N5Y9_MCL1-01      -----------------------------------ggatgggtttgtggagttcttccat
H2N5Y9_MCL1-02      acaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
H2N5Y9_MCL1-03      acaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
                                                       *************************

H2N5Y9_MCL1-01      gtagaggacctagaaggaggcatcagaaatgtgctgctggcttttgcaggtgttgctgga
H2N5Y9_MCL1-02      gtagaggacctagaaggaggcatcagaaatgtgctgctggcttttgcaggtgttgctgga
H2N5Y9_MCL1-03      gtagaggacctagaaggaggcatcagaaatgtgctgctggcttttgcaggtgttgctgga
                    ************************************************************

H2N5Y9_MCL1-01      gtaggagctggtttggcatatctaataagatagccttactgtaa
H2N5Y9_MCL1-02      gtaggagctggtttggcatatctaataagatag-----------
H2N5Y9_MCL1-03      gtaggagctggtttggcatatctaataagatag-----------
                    *********************************           

© 1998-2022Legal notice