Dataset for CDS Unclassified of organism Phallusia mammillata

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A6F9DJR1_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Phallusia mammillata (length=648 residues).
atggttcataaaactaggcgcattgtcgaaagatatatatttaataaagttaaatctttacttaacaatacgccacaaca
atttgaatctcacctctccataatttatcaatctgataacaacccatctcctgttcatctcgctgtgcagagagcagcag
aaaattatgaaattcgatacaaggaagcttttccagatttaatggatcaaatgaggacaacaaatacaacaacagaggac
attgaaggtttgttcacaaaaatatcaactgaactttttcaactccacaaaaaagaatctgataccaccaatgttaatgg
cgaactgataaagtggggccatgtcatggctttgtttgtttttgctggtgttcttgccacacgtgctgttgagctaaata
gcttgcatcaagttgattccataatttcatgggttaccgacttcctggaccaagatttatcatcctggctgaaaagacaa
ggcggttgggaaaactttattgaatgggcagaaaaacttgataattcaaaccaagaggacattcaaaacttgccaccaaa
tttcggacaaggaatgcggtcattaatgggtgttggtgttttagcagcttgtgtaggactgggtgctgtttttttaatcc
acaaataa
© 1998-2020Legal notice